ADSA 2024 Recordings

Session Session_Type Science_Section Session_Date Tracking_Number Watch Abstract_Number Title Session_Order Presenting_Author Combined_Keywords Combined_Authors Abstract
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 s10633                
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t91699 Watch 1191 Deriving novel traits to predict feed intake using data from sensors and other novel technologies. 1 J. E. Koltes dairy cattle,feed efficiency,precision livestock technologies J. E. Koltes1, L. M. James1, M. S. Mayes1, C. J. Cooper1, K. L. Gaddis2, R. L. Baldwin3, J. E. Santos4, F. Peñagaricano5, H. M. White5, K. A. Weigel5, R. J. Tempelman6, M. J. Vandehaar6 "Feed efficiency is an economically and environmentally important trait in dairy cattle. Estimating feed efficiency requires individual animal feed intake, milk yield and components, and ideally information about body weight and body condition score. Unfortunately, apart from milk traits, these data are rarely available on commercial farms as they are cost prohibitive. Thus, there is a need to identify new indicator traits for feed efficiency. Milk testing and sensor data represent existing information streams on dairy farms that may be able to serve as proxies for traits composing feed efficiency. Multiple experiments were conducted to evaluate the utility of these data. Five different types of sensors measuring activity, rumen traits, and temperature were evaluated for their phenotypic association with feed efficiency traits. Heritabilities were estimated for 3 sensor-based traits from repeated records for eartag and milking collar-based sensors, respectively. Estimated heritabilities were 0.21 (eartag activity), 0.14 (eartag rumination), and 0.17 (collar activity). Milk metabolites were also investigated to identify metabolites associated with or predictive of feed intake. Extreme cows for residual feed intake (RFI; top and bottom 15%) were selected. Three assays were performed: gas chromatography mass spectrometry, liquid chromatography mass spectrometry, and fatty acids inferred from Fourier-transformed infrared spectrometry. A total of 33 metabolites and 10 pathways were identified as statistically associated with feed intake. Milk fatty acid data were predictive of feed intake with an R2 of 0.86 and a concordance correlation coefficient of 0.92 based on an across cow cross-validation approach using a random 25% of cows, independent of the training set, as the testing set. Although further validation is needed, these studies indicate that sensor data could be useful as indicator traits for feed intake and milk-based data may be predictive of feed intake."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t91589 Watch 1200 Exploring Siamese neural networks for few-shot individual recognition of dairy cows in open-set scenarios. 10 A. A. C. Alves animal identification,computer vision,few-shot learning A. A. C. Alves1, R. E. P. Ferreira2, G. J. M. Rosa2, J. R. R. Dorea2 "Computer vision systems (CVS) for individual animal recognition are commonly developed to handle closed-set scenarios, limiting inferences to a fixed group of animals. These CVS require additional data annotation and model retraining when dealing with individuals not included in the initial training set. In this study, we explored Siamese neural networks (SNN) for few-shot individual recognition of dairy cows that were not included in the original data set (open-set scenarios). Top-down view images from 92 lactating cows were captured twice a day for about 3 mo, generating a total of 19,339 frames. This data set was split chronologically into training and validation sets, containing 15,659 and 3,680 images, respectively. Training images from 77 cows were used to implement different SNN models to classify image pairs as similar or dissimilar. We considered different architectures for the network backbone (VGG19, Xception, and ResNet50) as well as 2 different loss functions (binary cross-entropy and triplet loss). The trained networks were used to classify 15 cows that remained unknown during the training process. A limited number of training images (up to 11) for each of those 15 animals was randomly selected to compose the support data set. The SNN models were used to identify the animals in the validation data set based on their similarity with the support data set. The classification accuracy (mean ± SD) for the 15 cows ranged between 0.79 ± 0.05 and 0.91 ± 0.05 when using only one support image per animal. Additionally, average values for precision, recall, and F1-score were very similar to the obtained accuracies. Regression analysis showed accuracy plateauing after 5 or 7 support images per animal. The best overall performance was obtained with the ResNet50 architecture, achieving a classification accuracy of 0.96, considering 5 support images per animal. In conclusion, the results indicate the suitability of using SNN for recognizing new animals without need of extensive model retraining or data annotation, facilitating technology transfer to support data-driven decisions across farms."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t91483 Watch 1201 Genomic predictions for greenhouse gas emission traits in Holstein cows. 11 D. Liang genetics,dairy cattle,methane G. Oliveira Jr.1, M. Borchers1, K. Borchers1, D. Liang1, M. Li1, A. Kulkarni1, G. Vargas1, N. Vukasinovic1 "Concerns about greenhouse gas emissions from dairy farms have been growing in recent years. Reducing methane emissions via genetic selection can be vital for the long-term sustainability of the dairy industry. The objective of this project was to estimate genetic parameters for methane production (MetP; g/d) and residual methane production (RMet; g/d) using data from commercial Holstein herds. A total of 32,615 weekly averages of daily MetP measured on 4,163 Holstein cows from June 2022 to November 2023 were used in this study. These data were collected in 4 commercial herds using the GreenFeed equipment. RMet was defined as the residual of a linear regression of MetP on energy-corrected milk, metabolic body weight, and other environmental effects. Genetic parameters were estimated using a univariate animal model with repeated records using the AIREMLF90 software. This statistical model included year-season of calving, week of lactation, lactation number, and herd-year of calving as fixed effects. The predicted variance components were then used to estimate breeding values (EBV) including genomic data of over 2 million animals in a single-step genomic BLUP (ssGBLUP). Reliabilities of EBV were estimated using accf90GS v2.54 program. The phenotypic mean (SD) of MetP and RMet was 364.28 (72.99) and 0.00 (59.94) g/d, respectively. Heritability estimates (SD) for MetP and RMet were 0.25 (0.04) and 0.30 (0.05), respectively. The EBV of phenotyped animals had mean (SD) of 1.69 (20.13) and 3.17 (29.62) g/d for MetP and RMet, respectively. The reliability of EBV for MetP had mean (SD) of 0.43 (0.04) for phenotyped animals, 0.35 (0.06) when considering only animals with genotype information, and 0.23 (0.16) when accounting for all animals. Likewise, the reliability for RMet’s EBV had mean (SD) of 0.69 (0.04) for phenotyped animals, 0.55 (0.05) when including only animals with genotype data, and 0.35 (0.26) across all animals. The results of this study show that there is considerable genetic variation among the animals regarding methane emission and demonstrate that a large-scale genomic selection for reduced methane emission in dairy herds is feasible."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t91163 Watch 1192 Genetic characterization of daily feeding pattern in lactating Holstein cows and its association with feed efficiency. 2 L. Cavani area under the curve,heritability,RFI L. Cavani1, K. L. Parker Gaddis2, R. L. Baldwin3, J. E. P. Santos4, J. E. Koltes5, R. J. Tempelman6, M. J. VandeHaar6, H. M. White1, F. Peñagaricano1, K. A. Weigel1 "Feeding behavior traits, such as number, duration, or intake per feeder visit, have been studied and associated with feed efficiency in dairy cattle. Those traits, however, do not fully capture a cow’s feeding pattern throughout the day. The goal of this study was to propose a new phenotype for characterizing within-day feeding pattern and estimate its heritability and its genetic correlations with dry matter intake (DMI), secreted milk energy (MilkE), metabolic body weight (mBW), and residual feed intake (RFI). Feeding patterns were evaluated using 4.8 million bunk visits from 1,684 mid-lactation Holstein cows collected from 2009 to 2023 with an Insentec system. Daily bunk visits were ordered, with time zero designated as the time of the first feed delivery. Intake proportions per cow per day were calculated by dividing feed intake per visit by the total intake of the cow for that day. Feeding pattern was characterized by the area under the curve (AUC) of cumulative feed intake proportions for each cow each day. The feeding pattern phenotype per cow was defined as the average AUC across days, whereas consistency of feeding pattern was calculated as the log variance of daily AUC values (log-Var-AUC). Genetic parameters were estimated using an animal model, with lactation, days in milk, and cohort as fixed effects and animal as a random effect. Heritability estimates for AUC and log-Var-AUC were 0.35 ± 0.07 and 0.16 ± 0.06, respectively. Genetic correlations between AUC and DMI, MilkE, mBW, and RFI were −0.18 ± 0.12, −0.30 ± 0.14, 0.16 ± 0.10, and −0.18 ± 0.14, respectively. Log-Var-AUC was genetically correlated with DMI (0.47 ± 0.15), MilkE (0.40 ± 0.17), mBW (0.28 ± 0.13), and RFI (0.24 ± 0.14). These results suggest that cows that consume most of their total daily intake in the first few hours after feed delivery (larger AUC) and cows that have consistent daily feeding patterns tend to be more feed efficient. Overall, feeding pattern is heritable and genetically associated with feed efficiency."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t90959 Watch 1193 Development and genetic evaluation of novel resilience traits in Holstein cattle utilizing precision calf-feeding technologies. 3 J. Graham resilience,precision livestock farming,genetics J. Graham1, M. Taghipoor2, L. Gloria1, J. Boerman1, A. Rocha1, L. Brito1 "Precision livestock farming (PLF) holds promise for assessing and enhancing resilience in dairy cattle. This study employs random regression models to analyze calf milk consumption, aiming to derive novel traits and estimate genetic parameters related to resilience in Holstein calves. We utilized the BLUPF90+ suite of programs to integrate genomic and pedigree data from 10,076 calves genotyped with a 50k SNP panel. Variance components were estimated using Bayesian sampling methodology. Longitudinal data, collected from 2015 to 2021, encompassed Förster-Technik calf feeding records and family and health status data from Dairy Comp software. We developed a data-driven model based on functional data analysis, using penalized quantile regression to quantify calves’ responses to environmental perturbations. Various resilience indicators were assessed, including amplitude of deviation, perturbation time, recovery time, velocity parameters, and disease-related traits. Systematic effects such as feeding day, birth weight, pen density, dam parity, and contemporary groups (defined based on pen and management characteristics) were considered. Model selection for genetic parameters was based on Bayesian information criterion scores. Significant heritability estimates were obtained for several resilience indicators, ranging from 0.16 to 0.52, underscoring the genetic component of resilience traits in dairy calves. Our findings contribute to a deeper understanding of resilience mechanisms and inform breeding strategies for more resilient dairy cattle better capable of withstanding environmental and health challenges. This study highlights the potential of PLF technologies, combined with advanced genetic analyses, to enhance the resilience and sustainability of dairy farming operations, ultimately contributing to improved animal welfare and farm productivity. Further research is warranted to validate these findings and refine breeding programs targeting resilience traits in dairy cattle."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t90855 Watch 1194 Calculating resilience indicators in US Holstein cows using pen-level data. 4 F. L. Guinan resilience,pen-level perturbations,daily milk weights F. L. Guinan1, R. H. Fourdraine2, F. Peñagaricano1, K. A. Weigel1 "Resilience is defined as an animal’s capacity to bounce back to normal functioning after a perturbation or maintain specific functions in the face of change or stress. Dairy herds in the United States typically group cows into pens based on factors such as parity, lactation stage, reproductive status, and milk production. By coupling daily milk yield data with day-to-day pen location information, we can more precisely model management conditions and environmental stressors affecting individual cows for each day of the lactation. It also allows us to detect management and environmental perturbations that may occur each day at the pen level and subsequently measure the responses of individual cows to these stressors. Our data set included daily milk weights and pen locations of 4,183 primiparous cows in 10 US herds from 2018 to 2023. Individual lactation curves were fitted using polynomial quantile regression with a 0.5 quantile to derive expected lactation curves. Our resilience phenotype was defined as the percentage change in daily milk production for a cow on a given day relative to her preceding 7-d average. Perturbed days were identified based on residuals between expected and observed daily milk yields, and such days had 70% or more negative residuals for at least 5 consecutive days in a given pen. The statistical model included age at first calving and herd-pen-milking-date as fixed effects and additive genetic and permanent environmental as random effects. Estimated heritability of relative change in milk production on perturbed days was 0.08 (0.02), while estimated repeatability was 0.41 (0.01). Our findings suggest that animals differ in their response to perturbations at the pen level, and this measure of resilience in daily milk yield is heritable and repeatable. Identifying perturbations at the pen level on specific days can more effectively capture the management and environmental conditions affecting an individual cow at a given time, and resilience can be measured by comparing how her response differs from that of her contemporaries, which enables producers to make more informed decisions through selection and management strategies."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t92027 Watch 1195 Novel phenotypes for selecting for increased heat tolerance. 5 L. M. Jensen heat tolerance,conformation,body depth L. M. Jensen1,2, M. Haile-Mariam1, S. Bolormaa1, J. E. Pryce1,2 "Cows are negatively impacted by heat stress, which results in reduced milk yield, decreased fertility, and diminished animal welfare. These effects will continue to grow as more dairy producing regions are increasingly impacted by climate change. Australia is the first country to introduce a genetic evaluation for heat tolerance, by evaluating the decline in milk production as temperature and humidity increase as a phenotype. Moreover, there are other opportunities to expand the selection criteria by exploring additional predictors as phenotypes for evaluating heat tolerance in dairy cattle, which can be incorporated into the current breeding value. This can enable us to identify cows that are more tolerant to heat. It has been shown that heat loss is related to the surface area per unit of body weight; therefore, cows with a larger ratio of surface area to mass (SA:M) could be more heat tolerant. Considering the practical difficulty to obtain a large amount of SA:M data from many commercial dairies, body depth is considered to be a proxy for SA:M. It was hypothesized that cows with less body depth, therefore higher SA:M, will have greater heat tolerance. For this analysis, 191,205 first-lactation Australian Holstein cows with test-day milk records and official classification scores from 1999 to 2021 were used. The test-day milk yield data were merged with temperature-humidity index (THI) from the nearest weather station. Cows were classified as shallow, average, or deep bodied based on classification score (1–9). Statistical analysis was performed using a linear mixed model that included fixed effects of year-season, age at calving, days in milk at test-day (DIM), THI, and the interaction between body depth and THI, and the random effect of herd-test-date. The result shows a significant effect (P < 0.001) of body depth-THI interaction on milk yield. Cows with a deep body depth (score ≥7) saw a greater reduction in milk yield as THI increased. The initial findings suggest that classification measurements can be used to predict heat-tolerant cows and warrant further investigation."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t91316 Watch 1196 Estimation of variance components for multiple electrical conductivity traits derived from automatic milking system data in Holstein cows. 6 J. M. Maskal electrical conductivity,automatic milking system,Holstein J. M. Maskal1, S. Y. Chen1,2, K. Kalbaugh1, J. P. Boerman1, L. F. Brito1 "Mastitis is the most common and economically costly disease in dairy production. Subsequently, dairy producers stand to benefit from the development of novel traits that can improve resistance to mastitis. Therefore, traits derived from measures of electrical conductivity (EC) in milk may be key auxiliary traits for increasing resistance to mastitis in dairy populations. The primary objective of this study was to investigate the genetic background of multiple EC traits, incorporating data collected from automatic milking systems (AMS) and genomic information. Data were collected from 36 Lely Astronaut AMS for a period of 3 years on 3,868 Holstein cows. The AMS provided records of EC for each of the 4 quarters of the mammary gland (left-front_EC, left-rear_EC, right-front_EC, and right-rear_EC) for every milking visit. Two additional traits were derived from the data collected from the 4 quarters: the average of EC records per visit (averageEC) and the maximum EC of records per visit (maximumEC). To create daily estimates, records for each trait were averaged by day for all traits except for maximumEC, which was recorded as the maximum EC record within a day. All individuals were genotyped, and a total of 57,282 SNPs were utilized to calculate genomic relationships. Variance components were estimated for all daily traits using a single trait repeatability model utilizing (Average Information) REML in the BLUPF90 suite of programs. Heritability estimates ± SE for EC traits ranged from 0.12 ± 0.01 for maximumEC to 0.43 ± 0.02 for averageEC, while repeatability estimates ranged from 0.41 ± 0.006 for maximumEC to 0.64 ± 0.007 for averageEC. These preliminary results show that traits utilizing measures of EC have potential for genetic selection and future research needs to be done to fully evaluate the potential of EC traits as indictors of mastitis resistance."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t91011 Watch 1197 Genetic and genomic evaluations of milking speed and duration from automated milk recording. 7 J. R. O’Connell milking speed,heritability,genomic prediction J. R. O’Connell1, A. M. Miles2, J. L. Hutchison2, S. Toghiani2, R. H. Fourdraine3, P. M. VanRaden2 "Many milking systems now record milk produced and the duration (DUR) of each milking for every cow. Suitability of milking speed (MSPD) or DUR traits for selection and phenotype data required to produce a reliable evaluation were investigated. Records from January 2022 to December 2023 were retrieved by Dairy Records Management Systems, comprising data from 305 herds, 9 different equipment manufacturers (OEM), and 23,201 complete lactations of 23,180 cows, including 4,246 genotyped cows. Milking speed (MSPD) was defined as milk yield divided by DUR for each individual milking. Eight traits were compared: (1) average of total lactation on data for all parities, (2) average of DHI test days (TD) for all parities, (3) average of total lactation data for first parity (P1) only, (4) average of TD for P1, for each MSPD and DUR. Breed, milking frequency, parity, and OEM were included in the genetic model along with genetic groups and permanent environment. The pedigree relationship matrix included 219,703 animals with records or descendants with records, plus 96 million other animals. Variances were estimated by both Gibbs sampling and REML and were very similar. For MSPD, residual variance was 51% higher for TD traits compared with total lactation. MSPD TD heritability was 28% vs. 37% for total lactation data; genetic correlation between them was 0.97. MSPD was less stable in P1 compared with other parities, but genetic correlation was 0.92, suggesting they are measuring the same trait. MSPD had a small favorable genetic correlation with milk yield but unfavorable with somatic cell score based on 756 Holstein bulls with reliability (REL) for MSPD >50%. Heritability for DUR was higher than MSPD at 44% across all parities and 48% for P1. Genetic correlation of DUR with MSPD was −0.81, and phenotypic correlation was −0.52. Genomic predictions for MSPD for young animals averaged 37% REL compared with ~70% REL for several other traits or 27% REL for genomic predictions of residual feed intake. We conclude that evaluations for MSPD or DUR are not only feasible but would have significant economic impact for producers using various milking systems."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t91645 Watch 1198 Dairy calf health and growth monitoring through camera phenotyping techniques. 8 M. Liao automated camera,body weight prediction,diarrhea detection M. Liao1, J. Duncan1, Y. Bi1, G. Morota1, R. Cockrum1 "Effective monitoring of dairy calf health and growth is crucial for ensuring their well-being and productivity within the dairy industry. The objectives of this research were to (1) predict the body weight (BW) of dairy Holstein calves using an automatic recording system and (2) identify dairy Holstein calf diarrhea through predictive modeling. Heifer calves (n = 20) BW was collected manually via an electronic scale. Depth cameras captured videos of calves, and image processing techniques were employed to extract video body metrics, including width, length, height, and volume. A correlation matrix was computed using the Pearson correlation coefficient to determine the relationships between BW and body metrics using the ggcorrplot package and a linear regression model was used to predict BW, with 80% of the data set reserved for training using sklearn.linear_model package in R. A security camera was also used to collect videos of pre-weaning calves’ (n = 54) posterior images that were manually labeled into 4 health levels (healthy, mild, moderate, severe) using the annotation tool labelImg. Using 80% of the data for training and 20% for testing, a customized YOLOv8 model was developed in a Linux environment. There were strong and positive correlations between body volume (0.83), height (0.75), width (0.71), and length (0.74) with BW. The predictive model from camera images achieved an accuracy of 0.8. Additionally, the automatic recording system was designed to activate once an object was detected within the region of interest. Moreover, the diarrhea prediction model demonstrated strong prediction accuracies: 0.94 for healthy, 0.97 for mild, 0.95 for moderate, and 1.0 for severe cases. This research demonstrates the application of camera technologies in monitoring dairy calf health effectively and non-invasively. By accurately predicting BW and detecting diarrhea at an early stage, these systems could assist producers in managing calf growth and health more efficiently."
Breeding and Genetics Platform Session: Deriving Novel Traits from Sensors and Other Technologies for Breeding Purposes Platform Session Breeding and Genetics 2024/06/17 13:30:00 t91934 Watch 1199 Precision breeding opportunities using robotic milking data. 9 J. P. Nani robot milking,precision breeding,animal welfare J. P. Nani1, S. Arens1, A. Sewalem1, B. Shonka-Martin1, L. Chang1, M. McClure1 "The increased use of robotic milking machines has revolutionized dairy farming practices by introducing advanced tools for milk production and herd management. These robotic systems also serve as data collection platforms, generating valuable information regarding milk production, cow health, and behavior that can be later used in breeding programs. Data were obtained from 136 Lely automatic milking systems (AMS) farms from 8 different countries from the Americas and Europe. In total 34,552 lactating cows from lactation 1 to 5 contributed with >60 million datapoints. Box time was calculated as the time in minutes spent in the milk pen for every visit. Dead time was calculated by subtracting the milk time to the total box time in the pen and averaged (Table 1). Although box time increased with lactation, dead time decreased from lactation 1 to 3, to start increasing again in lactation 4 and 5, indicating that there is an adaptation time to the system during early lactations. As expected, milk time was highly correlated with box time, and milk yield was moderately correlated with milk time (Table 2). Milk yield and milk time had lower correlation with dead time, indicating that cows with lower dead time would be desirable, as they seem to better adapt to AMS without compromising production. In summary, collecting and analyzing information from robotic milking machines is a powerful tool for the dairy industry to identify animals that will perform better in these systems, and that will in turn enhance productivity, improve animal welfare, optimize resource use, and drive continuous improvement for the industry through precision breeding. Table 1 (Abstr. 1199). Average box time and dead time by lactation
Lactation Avg. box time (min) Avg. dead time (min)
1 6.86 2.35
2 6.83 2.30
3 7.04 2.29
4 7.30 2.32
5 7.51 2.35
Table 2 (Abstr. 1199). Correlations between box time (BT), milk yield (MY), milk time (MT), and dead time (DT)
Lactation Cor BT/MT Cor MY/MT Cor MY/DT Cor MT/DT
1 0.92 0.51 −0.15 −0.04
2 0.93 0.52 −0.12 −0.09
3 0.94 0.52 −0.12 −0.10
4 0.94 0.53 −0.11 −0.11
5 0.95 0.55 −0.10 −0.11
"
Extension Education Platform Session: Training Dairy Workforce—Industry Needs and Ongoing Initiatives Platform Session Extension Education 2024/06/17 13:30:00 s10635                
Extension Education Platform Session: Training Dairy Workforce—Industry Needs and Ongoing Initiatives Platform Session Extension Education 2024/06/17 13:30:00 t90862 Watch 1208 Needs assessments to identify educational and outreach opportunities for dairy producers and employees. 1 J. Heguy needs assessment,survey,California J. Heguy1, R. Branco Lopes2 "The US dairy industry has undergone substantial change in the last decade. Fewer dairies house a larger number of cows that produce more milk. Industry consolidation, increased technical services from allied industry specialization, and the widespread availability of web-based information have changed the way dairy producers obtain information. Delivery of unbiased, university research information is critical, but has become increasingly difficult in some dairy producing regions. A key challenge for extension professionals is to develop relevant programs that meet the needs of a changing industry. Conducting needs assessments offers a viable strategy to identify the changing needs of the dairy industry. Information gained can be utilized to better serve clientele through evolving extension programs. In this symposium, we will discuss the importance of needs assessments to guide research and extension education programs. In California, for example, the regulatory climate necessitates periodic assessment updates to identify emerging producer priorities. These key issues and concerns can be identified through direct or indirect assessment methods. This symposium will explore both direct methods, such as surveys and focus groups, and indirect methods that engage clientele through discussions to identify needs and priorities. Results from published literature and assessment methodology case-studies will be presented. We will highlight recent efforts by the University of California Cooperative Extension dairy team to build cooperative, effective working relationships with dairy producers and employees based on a needs assessment survey that prioritized research topics, preferred audience for extension programs, and method of information delivery. The presentation will include personal experiences highlighting the significant impact of needs assessments on refining and enhancing dairy research and extension outreach programs in California to be more aligned with, and responsive to, the dairy industry’s needs."
Extension Education Platform Session: Training Dairy Workforce—Industry Needs and Ongoing Initiatives Platform Session Extension Education 2024/06/17 13:30:00 t91509 Watch 1209 Framing Extension strategies for facilitating the adoption of dairy farming practices. 2 L. da Costa deliver strategies,extension communication,dairy L. da Costa1, M. Rovai2, N. Silva-Del-Río3 "Extension programs seek to enhance collaboration among farmers, researchers, and industry experts to share knowledge, conduct research, and advocate for best practices within the sector. Effective extension strategies are essential to bridge the gap between research and on-farm implementation. In a collaborative effort, scientists and extension practitioners should assist farmers by combining various extension methods (stacking) to provide practical guidance and mitigate challenges. These strategies encompass technologies, the adoption of practices, and the application of new knowledge from research. Over the years, attention has focused on understanding the drivers and barriers to the adoption of these methods, and it is progressively recognized as a dynamic process involving learning and gradual transformation rather than the implementation from a singular event. Different farmers follow diverse adoption pathways, influenced by social and behavioral changes. Despite progress, the adoption of practices within the dairy sector remains a challenge. Several aspects are crucial when designing extension programs to achieve success. These programs should be customized based on local context, considering available resources, socioeconomic conditions, and cultural nuances. It is crucial to avoid a “one size fits all” approach by tailoring messages based on farmers’ existing knowledge, appropriate language, and delivery strategies, as well as considering farm size and management systems. Examples of technology used in extension programs include E-extension methods (utilizing digital tools and online platforms, such as webinars, to disseminate information and provide guidance), software data-driven decision-making (improving milk quality, production data, feed management, and breeding), technology development (creating mobile apps for herd monitoring). Framing extension strategies is complex and involves a holistic approach and the combination of methods (technology, field days, farm schools) strategically used to enhance their effectiveness and promote the adoption of practices that empower dairy farmers with relevant knowledge and skills."
Extension Education Platform Session: Training Dairy Workforce—Industry Needs and Ongoing Initiatives Platform Session Extension Education 2024/06/17 13:30:00 t90939 Watch 1210 Online dairy employee training with standardized SOPs: Assessing applicability and behavior change. 3 W. Heuwieser extension,training,udder health W. Heuwieser1, M. Zurakowski1, S. Neukirchner1, P. Virkler1 "It is well known that poor implementation of critical steps can impact calf and udder health outcomes. Standard operating procedures (SOPs) are step-by-step instructions to ensure quality in task execution. We conducted 2 studies with ready-made SOPs (accessible through a website) to evaluate their perception in calf care and to assess the impact of SOPs on employees’ behavior while performing dry-off procedures. In study 1 (S1), SOPs for 8 tasks in calf care were provided online to dairy farmers and employees in Germany (n = 301). With 5 questionnaires we collected data on demographics, use, and feasibility of SOPs. The effect of training on dairy employees’ behavior has not yet been studied. Therefore, the objective of study 2 (S2) was to determine the effect of online training on employee behavior. Five training modules on udder health were developed. Participants from the US navigated the modules at their own pace or watched a narrated video. Employees (n = 60) were assessed performing 2 tasks related to dry cow treatment (antibiotic, teat sealant) with an objective structured clinical examination (OSCE). A discrepancy existed between availability (13.1%) and wish for SOPs (69.4%) in S1. Most participants rated ready-made SOPs as feasible for their farm (66.5%). This result provides evidence that the notion of calf rearing being too diverse to use ready-made SOPs is not justified. 85% fully agreed or agreed that SOPs are a suitable tool for training new employees. Interestingly, 64.2% of employees were interested in getting involved in the creation of SOPs. The courses increased the confidence in performing tasks in calf care, especially for tasks that were less often performed (tube feeding, testing colostrum). In S2 most participants (72%) watched the video, and 28% browsed the modules at their own discretion. In total, 29 and 19 employees were scored pre- and post-training for treating a cow at dry-off and for administering internal teat sealants, respectively. The OSCE score (max. 20 points) improved for both modules from 12.4 and 11.4 pre-training to 15.3 and 13.7 post-training. After training 83% and 90% of the participants had improved."
Extension Education Platform Session: Training Dairy Workforce—Industry Needs and Ongoing Initiatives Platform Session Extension Education 2024/06/17 13:30:00 t91293 Watch 1211 From research to on-farm practices: An evidence-based approach to knowledge mobilization. 4 E. Wynands knowledge mobilization,scientific communication,extension E. Wynands1, J. Saraceni1, C. Wright1, D. Renaud1,2, A. L’Espérance3, É. Désilets3, S. Roche1 "Mobilizing research knowledge is an important part of supporting on-farm decision-making and change. Best practices for knowledge mobilization (KM) include information exchange, dissemination, and collaboration among researchers and research users. The objective of this work was to use a collaborative approach to share results from 15 national, multidisciplinary, 5-year research projects funded in-part by Dairy Farmers of Canada. The project topics included dairy production, animal health, and sustainability. Knowledge mobilization outputs and events were planned and executed to meet the needs of the target audiences, including dairy farmers (primary audience), as well as farm advisors and dairy industry professionals (secondary audience). The KM outputs developed included podcasts (n = 22), trade publications (n = 15), infographics (n = 14), webinars (n = 12), animated videos (n = 8), in-person events (n = 7), live-action videos (n = 2), and a research highlights magazine (n = 1). A central hub website was used to host all materials, and a communication plan was created to share outputs with stakeholders. Communication efforts included a notification email to the 10 provincial milk marketing boards and industry organizations to request direct support in sharing with their members, and 4 unique emails sent to a mailing list of approximately 4,000 people (a combination of researchers, farmers, and industry stakeholders). Select individual outputs were promoted by research teams and shared via LinkedIn and newsletters. The collaborative development process highlighted the importance of early engagement and relationship building with the research teams. Research teams have different willingness and capacity to engage with developing KM outputs; therefore, having a flexible strategy to accommodate different interests and motivations was critical. When developing outputs, it was key to build consensus on the purpose of sharing the information and the needs of the target audience. This end-of-project KM strategy was a successful approach for developing and sharing research outputs with farmers and dairy industry professionals."
Extension Education Platform Session: Training Dairy Workforce—Industry Needs and Ongoing Initiatives Platform Session Extension Education 2024/06/17 13:30:00 t91823 Watch 1212 Building value in sustainability assessments for dairy farmers and advisors: A qualitative analysis. 5 M. G. Erickson sustainability,environmental,assessment M. G. Erickson1, M. Rovai2, P. Villamediana2, A. M. Schmidt3, R. R. Stowell3, E. L. Cortus1 "Major industry-led efforts aim at reducing the cradle-to-farmgate environmental impacts of milk production (e.g., the US Dairy Net Zero Initiative). Sustainability metrics are increasingly available to producers, through assessment processes often mediated by processors. Our qualitative, exploratory work aimed to characterize farmer and advisor perceptions of an environmental sustainability assessment program (the FARM Environmental Stewardship Module) in the Upper Midwest. In autumn of 2023, we held a series of 2–3 focus groups for each of 5 regions (n = 14 meetings total) including farmers (n = 22), advisors (n = 13), and processor representatives (n = 1). For each region, we used an initial meeting centered on region-specific fictional assessment reports to investigate participant perceptions of the value in sustainability assessments. Facilitators guided participants through semi-structured prompts to generate qualitative data. We first coded transcripts to identify quotes related to the value of assessments and individually assigned open codes. Then, we organized results into themes and sub-themes through collaborative axial coding. Results suggested that participants valued the simplicity of the assessment, including its low requirements for input data and the availability of regional comparisons. Conversely, participants reported skepticism about accuracy and fairness, drawing attention to the model’s over-simplicity and its potential to be leveraged in power dynamics among farmers and processors. Participants stated that the assessment supported baseline data numeration, creating value for processors and retailers. However, they expressed that the report alone had questionable value as a decision support tool or catalyst to action without other implementation support structures such as peer discussion, expert advising, and financial incentives. Our results illustrated that farmers and advisors identified tradeoffs between simplicity and accuracy, and a need to support dairies not only in completing baseline assessments but also in implementing environmental sustainability improvements. "
Extension Education Platform Session: Training Dairy Workforce—Industry Needs and Ongoing Initiatives Platform Session Extension Education 2024/06/17 13:30:00 t91264 Watch 1213 Identifying the antimicrobial stewardship competencies necessary for dairy farm workers. 6 G. Habing qualitative,extension,education D. Wilson1, E. Parker2, R. Portillo-Gonzalez2, P. Ruegg3, G. Habing2 "Dairy farm workers have responsibilities for disease prevention, diagnosis, and treatment, and need to employ good antimicrobial use practices. The objective of this research was to determine the competencies needed by farm workers to ensure prudent antimicrobial use on dairy farms. Qualitative methods were used to explore this topic, with 7 focus groups conducted, first with dairy veterinarians at 3 different veterinary conferences in the United States (n = 6) and then 1 focus group of Ohio dairy producers via video link. Focus groups followed a semi-structured question guide, had 4–9 participants and 2 to 4 facilitators each, and explored which professional and technical competencies are needed by dairy farmers who work with lactating cows and youngstock. These discussions were audio recorded, transcribed, and evaluated using thematic analysis, where a theme captured an important competency and was discussed in all groups. Preliminary results indicated that farm workers required knowledge and skills as listed in Table 1. Stakeholders also noted the importance of farm managers being competent in delegation, evaluation and monitoring, teaching, and having knowledge of dairy farm regulations (e.g., milk withhold times). Shared competencies between managers and farm workers included having a common language and using open and ongoing communication. The evidence provided through these focus groups can be used to provide structured education efforts to dairy farm workers to improve antimicrobial stewardship on dairy farms. Table 1 (Abstr. 1213). Antimicrobial stewardship competencies necessary for dairy farm workers
Item Disease diagnosis Disease prevention Disease treatment General or personal
Knowledge Etiology and pathology Prevention strategies Routes of transmission Zoonoses Implications of veterinary product use Veterinary product indications Farm assurance programs
Skills Observation Physical examination Use of diagnostic tools Cleanliness Maintenance of farm operations Following protocols Veterinary product administration Animal handling Consistency Responsibility and initiative Record keeping Synthesizing data to guide decisions Willingness to learn Ability to ask for help
"
Extension Education Platform Session: Training Dairy Workforce—Industry Needs and Ongoing Initiatives Platform Session Extension Education 2024/06/17 13:30:00 t91554 Watch 1214 Breakfast on the Dairy Farm: Dairy farmer experiences in delivering tours to members of the public. 7 A. M. C. Smid questionnaire,social sustainability,farmer experiences B. A. Ventura1, S. M. Roche2, A. Schaafsma3, H. W. Barkema4, W. Ruiter3, A. M. C. Smid4 "Events such as “Breakfast on the Dairy Farm” (BOTDF) are frequently used to educate the public about dairy farming. Despite work exploring the impacts of these public outreach efforts on the public, little is known about the farmers’ experiences regarding these efforts. Therefore, we investigated how Canadian dairy farmers (n = 26) experienced being a tour guide on a “Breakfast on the Dairy Farm” event. A secondary aim was to describe whether communication training of farmer tour guides using 1 of 2 styles (one-way education [A] versus dialog approach focused on identifying shared values [B]) influenced their experiences of the BOTDF events. A total of 4 focus groups (~90 min, 4–8 farmers/group) were conducted on Zoom and analyzed using reflexive thematic analysis. Here we focus on 2 themes: (1) farmers’ experiences with the event, and (2) farmers’ views toward the public. Overall, farmers described positive feelings toward the event, sharing that the tours went well, and that they enjoyed the chance to connect with and educate the BOTDF visitors. In addition, participants also shared that they enjoyed seeing their community coming together and collectively sharing their pride in their field. Participants shared both positive (e.g., public as curious and engaged), as well as critical (e.g., public as misinformed) views and mentioned that the most frequently mentioned visitor concerns revolved around cow welfare, antibiotic and hormone usage, and environmental impact of dairy farming. Group A farmers emphasized the importance of public education and maintained beliefs that this would reduce public concerns about dairy farming. Although group B farmers also shared beliefs around the importance of education, they also emphasized the importance of learning about public concerns as well. A mutual desire to understand others’ perspectives may present an important opportunity to align industry and public interests toward the shared goal of creating a sustainable dairy industry."
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Production‚ Management‚ and the Environment 2024/06/18 13:30:00 s10699                
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Production‚ Management‚ and the Environment 2024/06/18 13:30:00 t91900 Watch 1403 Revisiting the 45th ADSA Discover Conference—Dairy Cattle Lifespan: New Perspectives. 1 M. Lucy longevity,productive life,culling A. De Vries1, M. Lucy2, C. Baes7, N. Friggens3, P. Kononoff4, D. Nydam5, E. Vasseur6 "The 45th ADSA Discover® Conference was held October 23 to 26, 2023, in Itasca, Illinois. Extended dairy cow lifespan is said to be good for sustainability and the image of the dairy sector. In practice, however, the topic is complex and simple perceptions do not capture the breadth of the underlying questions. The conference was designed, therefore, to take an in-depth look at dairy cow lifespan and explore new perspectives in the modern era of dairy production. Speakers and attendees explored the many facets of lifespan including definitions (productive life vs. longevity or lifespan), the underlying biology, genetics, and genomic selection, and important management factors including nutrition and housing. Importantly, economics were modeled across different countries and the environmental impact was assessed for herds under different production systems and with different age structures. Producer and industry panels provided diverse ideas about goals for lifespan in different countries and communities. The conference was successful in that there were topics that were generally agreed-upon (replacement of an individual cow should be based on her competitive economic merit; long lifespan should not be the goal unless it supports profitability). Disagreements existed across speakers and attendees on the importance of lifespan to consumer perspectives of dairying as well as its environmental impact. These disagreements identified important knowledge gaps and opportunities such as quantifying maturity and future cow performance, and the importance of early lactation culling. Rapidly changing genetics of cows, technological advances that affect heifer supply (embryo transfer, sexed semen, etc.), new lucrative markets for dairy farms (including meat from cull cows and the sale of beef-dairy crossbred calves), and impending legislative action on climate change will impact dairy farms and their decisions to keep or cull their older cows. Despite advances in husbandry, precision dairy farming technologies, and decision support tools, when cows should be replaced and what replacement rates should be remain areas for further investigation."
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Animal Behavior and Well-Being 2024/06/18 13:30:00 t91753 Watch 1648 Long-term effects of preweaning social housing on heifer performance and reproductive development. 10 E. E. Lindner performance,social contact,welfare E. E. Lindner1, T. Martins2, C. Burner1, E. K. Miller-Cushon1 "Evidence supports short-term performance and welfare benefits of dairy calf social housing, but longer-term implications for dairy heifer development remain unclear. The objective of this study was to assess the effects of social housing during the preweaning period on dairy heifer growth and reproductive success. Holstein heifers were housed either individually (IH; n = 55), in pairs (PH; n = 55; 1 focal heifer/pair), or in groups (GH; n = 53; focal animals selected from 9 groups of 10 calves/group) from birth until 9 weeks of age. Beginning at 6 mo of age (189.9 ± 11.8 d of age), body weight (BW) and hip height were recorded weekly for 24 wk. Heifers were also placed with an Estrotect breeding indicator, which was examined 1x/week for evidence of behavioral estrus. Ultrasounds were performed weekly until confirmation of estrus with the presence of a corpus luteum. Data were analyzed in general linear models including previous housing treatment, birthweight and preweaning health score (% of evaluations with temperature >38.9°C). Preweaning housing did not affect BW (263.9 kg; SE = 2.92; P = 0.23) but hip height was consistently greater for previously PH and IH heifers compared with GH (124.9 vs. 124.0 vs. 122.2 cm; PH vs. IH vs. GH; SE = 0.45, P < 0.001). Age at first expression of estrus behavior (298.8 d; SE = 7.2; P = 0.33) and first estrus cycle (326.6 d; SE = 8.0; P = 0.59) did not differ. Preliminary analysis of calving outcomes (n = 130; IH = 46; PH = 50; GH = 34) suggested that treatment did not affect age at calving (695.7 d; SE = 6.2; P = 0.36), but previously PH heifers tended to weigh more at calving, compared with previously IH and GH heifers (657.3 vs. 631.7 vs. 636.2 kg; PH vs. IH. vs. GH; SE = 8.8; P = 0.06). These results indicate potential long-term effects of social housing on heifer growth, with similar reproductive outcomes across preweaning housing treatments."
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Production‚ Management‚ and the Environment 2024/06/18 13:30:00 t91392 Watch 1223 Effect of dry period heat stress and rumen protected choline on productivity of Holstein cows. 2 M. A. T. de Bari dairy cattle,heat stress,choline M. A. T. de Bari1, K. Estes2, C. Zimmerman2, H. Olmo1, D. Onan-Martinez1, J. Magalhaes1, N. Jeronymo1, J. Lance1, M. Martin1, L. C. Trevisan1, I. M. Toledo1, G. E. Dahl1 "Dry period heat stress significantly reduces milk yield in the subsequent lactation in cows. Altered methylation patterns in mammary tissues is associated with the decline in milk yield. We hypothesized that as a methyl donor, choline (RPC) supplementation reverses similar patterns of methylation and thus productivity in heat-stressed dams. Late-gestation Holstein cows (n = 51) housed in freestall barns were enrolled to either heat stress (HT, n = 12), HT with RPC (HTC, n = 11), cooling (CL, n = 14), or CL with RPC (CLC, n = 14). A cooling system including shade, fans, and soakers was provided to CL and CLC cows, whereas HT and HTC cows only had shade. Choline treatment consisted of 30 g of RPC per day mixed with TMR. Dry matter intake (DMI), rectal temperature (RT), and respiration rate (RR) were assessed in the dry period (DP), and milk yield was tracked for 60 DIM. Statistical analyses were performed using the PROC MIXED procedure of SAS. HT+HTC increased RR and RT (78.7 ± 2.3 vs. 61.7 ± 1.9 bpm; 39.3 ± 0.07 vs. 38.8 ± 0.05°C; P < 0.01) relative to CL+CLC. HT exposure reduced DMI relative to CL (13.2 ± 0.4 vs. 14.4 ± 0.3 kg/d; P = 0.01). DMI of HTC cows was lower relative to HT (12.4 ± 0.4 vs. 13.8 ± 0.4 kg/d; P = 0.02). Gestation length (GL) was shorter in HT (HT+HTC; 271.2 ± 0.5) versus CL (CL+CLC; 274.9 ± 0.5 d; P < 0.01). HTC had a shorter GL and DP compared with HT (268.6 ± 0.9 vs. 273.6 ± 0.8 d; 38.6 ± 1 vs. 43.2 ± 0.9 d; P < 0.01), whereas CLC had a longer GL and DP than CL (275.8 ± 0.6 vs. 273.9 ± 0.6 d; 46.6 ± 0.6 vs. 43.9 ± 0.6 d; P = 0.03). Colostrum yield (P < 0.01) was lower in HT+HTC (7.4 ± 0.5 kg) relative to CL+CLC (11.5 ± 0.5 kg). Cooled calves (CL+CLC) were born heavier than heat-stressed (HT+HTC) calves (37.9 ± 0.4 vs. 33.3 ± 0.5; P < 0.01). HTC calves were born lighter than HS calves (31.7 ± 0.6 vs. 34.7 ± 0.6 kg; P < 0.01). In CL, ECM was increased compared with HT cows (54 ± 1.6 vs. 47.5 ± 1.7 kg/d; P < 0.01). An interaction of ECM yield was observed among treatments (P = 0.06): CL = 53, CLC = 54.9, HT = 47.9, and HTC = 47.1 kg/d. These results suggest that choline does not mitigate the negative impact of heat stress in prepartum cows but improves ECM yield when combined with cooling."
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Ruminant Nutrition - Calves and Heifers 2024/06/18 13:30:00 t90766 Watch 1239 Short- and long-term effects of pasteurized waste milk on calf growth, health, and subsequent performance and longevity. 3 S. R. Li pasteurized waste milk,calf,long-term effects S. R. Li1, T. Y. Chen1, S. Liu1, S. L. Li1, Z. J. Cao1 "This study aimed to investigate the effects of pasteurized waste milk and milk replacer feeding on the growth and health of calves, as well as the long-term influence on milk production, health, and reproduction up to the fifth parity. A total of 240 newborn Holstein female calves (35.3 ± 5.7 kg) were randomly divided into 2 groups: pasteurized waste milk (PW, n = 120) or milk replacer (energy concentration adjusted to be consistent with PW based on the calculated energy content; MR, n = 120) feeding during the pre-weaning period. Upon birth, all calves received 4 L of colostrum within 1 h. From d 1 to d 7, calves were placed in individual hutches and fed 3 times a day. From d 8 to d 67, every 15 calves were transitioned sequentially according to age to a pen with automatic calf feeders, and gradually reduced feeding after d 40 and weaned on d 67. Data on feed intake, feces, cough scores, physiological parameters, and production up to fifth parity were collected. Data were analyzed using MIXED, ANOVA, GLM, and chi-squared test models of SAS 9.2. The results showed the PW group had a higher ADG (789.40 ± 195.31 g vs. 634.02 ± 192.29 g) but lower starter feed intake (251.60 ± 59.70 g vs. 359.80 ± 98.90 g) and diarrhea frequency (0.05 ± 0.13 vs. 0.14 ± 0.17) than the MR group during the pre-weaning period. Moreover, the MR group exhibited higher blood C3 (0.25 ± 0.11 vs. 0.37 ± 0.07) and cortisol (5.79 ± 5.00 vs. 12.63 ± 7.96) concentrations than the PW group 1 wk after weaning. The PW group’s first-parity colostrum quality was lower (Brix, 24.50 ± 2.70 vs. 27.50 ± 3.30), whereas the 305-d milk yield was higher only in the second parity (4,928.63 ± 2,393.92 kg vs. 3,949.52 ± 2,424.16 kg). No significant differences were observed in reproductive performance, health, or culling rate up to the fifth parity. In summary, PW positively influenced pre-weaning calf health and growth, but long-term outcomes up to the fifth parity showed no disparities in health, performance, or longevity compared with MR-fed calves, despite some specific parameter differences."
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Animal Health 2024/06/18 13:30:00 t91262 Watch 1311 A health monitoring program based on automated health alerts identified more cows with health disorders and improved herd performance compared with exclusive use of visual observation to select cows for clinical examination. 4 C. Rial dairy cow,health monitoring,sensors C. Rial1, M. L. Stangaferro2, M. J. Thomas2, J. O. Giordano1 "The objectives of this randomized trial were to compare the percentage of cows that underwent clinical examination and were diagnosed with clinical health disorders (HD), and the effects on milk yield (MY), the herd exit dynamics, and first insemination outcomes of a health monitoring program that relied only on automated health monitoring alerts or a program that relied only on visual observation to select cows for examination. Lactating Holstein cows fitted with a neck-attached rumination and physical activity monitoring sensor (SenseHub, Merck Animal Health) were randomly assigned to an automated health monitoring (AHM n = 607) or a visual observation (VO n = 597) group for monitoring health from 3 to 21 d in milk (DIM). Cows in the VO group were selected for clinical examination exclusively based on VO of clinical signs of disease, whereas cows in the AHM group were selected for examination based on health alerts (Health Index Score <86 arbitrary units, daily rumination <250 min, or a reduction of >20% in daily MY monitored 3×/d by parlor milk meters [MM32, DeLaval]). The clinical exam, conducted by the research team, was the same for both groups. Binary data were analyzed with logistic regression and continuous data by ANOVA with or without repeated measures. More cows underwent clinical examination (P < 0.01; AHM = 62%, VO = 29%) and were diagnosed with at least one HD (P < 0.01; AHM = 35%, VO = 21%) in the AHM than in the VO group. Cows in the AHM group had more accumulated milk than cows in the VO group from 2 to 21 DIM (P = 0.01; VO: 509 ± 14 kg, AHM: 542 ± 12 kg). Cows in the AHM group with HD produced more milk (P < 0.01) from 9 to 13 and 20 to 21 DIM than cows with HD in the VO group. No effects of treatments were observed on pregnancies per AI at first service (P = 0.57; VO = 37%, AHM = 39%) or the herd exit (P = 0.13; VO = 21%, AHM = 17%). Monitoring cow health based on automated monitoring systems data and alerts might be a more effective alternative for health monitoring than exclusive use of VO of clinical signs of disease."
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Production‚ Management‚ and the Environment 2024/06/18 13:30:00 t91899 Watch 1535 Association of uterine health in the first lactation with transition cow health and reproductive performance in the second lactation of Holstein dairy cows. 5 A. M. L. Madureira puerperal metritis,pregnancy loss,pregnancy per artificial insemination (AI) S. Borchardt1, T. A. Burnett2, M. Drillich1, K. Wagener3, A. M. L. Madureira2 "The objective of this study was to evaluate the effects of puerperal metritis (PM) on the first lactation (1st L) on transition cow health and reproduction of dairy cows in their second lactation (2nd L). Two farms were enrolled in this study (Farm A and B). In both farms, the following diseases were recorded during the first 30 DIM: clinical hypocalcemia, retained fetal membrane (RFM), PM, hyperketonemia, left displaced abomasum, and clinical mastitis. Cows were inseminated for first service using only timed AI after submission to a Double-Ovsynch protocol (Farm A) or inseminated after estrus detection using an automated activity sensor (Farm B). Based on the diagnosis of PM in the first and second lactation, cows were classified into 4 groups: (1) no PM in the 1st L and no PM in 2nd L (NoPM+NoPM), (2) no PM in the 1st L and PM in the 2nd L (NoPM+PM), (3) PM in the 1st L and no PM in the 2nd L (PM+NoPM), and (4) PM in the 1st L and PM in the 2nd L (PM+PM). A total of 4,834 cows (Farm A) and 4,238 cows (Farm B) in the 2nd L were considered for statistical analyses. Statistical analyses were performed using SPSS for Windows. On both farms, cows with PM in their 1st L had greater odds for RFM and PM in their 2nd L, while there was no association of PM in the 1st L with any other nonuterine diseases in the 2nd L. On Farm A, pregnancy per AI at first AI was 43.4 ± 1.3, 31.3 ± 2.7, 39.4 ± 2.3, and 44.3 ± 4.7% and on Farm B was 53.8 ± 3.4, 39.3 ± 4.9, 49.5 ± 4.3, and 23.7 ± 6.0% for 2nd L cows in NoPM+NoPM, NoPM+PM, PM+NoPM, and PM+PM, respectively. Pregnancy loss at first AI was 6.9 ± 0.7, 12.5 ± 3.0, 9.3 ± 1.8, and 18.8 ± 4.9% for 2nd L cows, on Farm A and on Farm B it was 8.6 ± 1.5, 19.6 ± 5.3, 11.8 ± 3.0, and 26.9 ± 11.6% for cows in NoPM+NoPM, NoPM+PM, PM+NoPM, and PM+PM, respectively. On both farms, there was an association with uterine health classification and pregnancy loss in second lactation at first AI. Puerperal metritis in the first lactation is associated with long-lasting negative effects for cows in their next lactation."
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Production‚ Management‚ and the Environment 2024/06/18 13:30:00 t91336 Watch 1542 Effect of dry cow vaccination and administration of a nonsteroidal anti-inflammatory drug on inflammation, immunity, and performance of dairy cows. 6 J. Gao dry-off,meloxicam,inflammation J. Gao1, G. G. Cunha1, N. L. P. Kant1, C. G. Savegnago1, T. N. Marins1, A. M. Roper1, S. Tao1 "This study aimed to examine the effect of dry cow vaccination schedule and administration of a nonsteroidal anti-inflammatory drug on inflammation, immunity, and subsequent milk yield (MY) in a commercial dairy farm. Standard operating procedure (SOP) at dry-off (DO) includes blanket dry cow therapy and vaccination (5 mL Enviracor J-5 subcutaneously, 2 mL Scourguard 4KC intramuscularly, and 5 mL Ultrabac 7 subcutaneously, Zoetis) after last milking. Dry cows were housed in a barn until calving. Lactating cows were milked 3×/d with MY recorded. In late lactation, healthy cows were blocked by parity, days in milk, and MY and then randomly assigned to (1) SOP (n = 56); (2) vaccination at −14 d relative to DO (DRD) (EV, n = 55); (3) vaccination at −14 DRD and oral administration of meloxicam at 0 (the day of DO) and 3 DRD (EN, n = 56). SOP and EV cows received placebo orally at 0 and 3 DRD. All cows were managed similarly after 3 DRD. Plasma was collected at −16, −12, −10, −5, 0, 1, 2, 3, 4, 5, 6, 10 DRD to analyze haptoglobin (HP). Blood hematological profiles were assessed at −15, −5, 2, 6 DRD. Neutrophil chemotaxis to interleukin 8 was measured in a Transwell system at −16 and 2 DRD. Peripheral blood mononuclear cells (PBMC) proliferation stimulated by concanavalin A and lipopolysaccharide was assessed at −15 and 3 DRD. Data were analyzed using PROC MIXED of SAS with block as a random effect. Giving vaccines earlier reduced (P ≤ 0.02) MY before DO but treatments did not (P = 0.70) affect MY up to 8 weeks in milk. EV and EN cows had greater circulating HP at −12 and −10 DRD while SOP cows had greater circulating HP at 1 to 6 DRD (P ≤ 0.01). Vaccination at DO increased circulating neutrophil and lymphocyte counts at 2 DRD than EV and EN (P ≤ 0.01). Treatments did not (P > 0.70) affect PBMC proliferation or neutrophil chemotaxis. In conclusion, giving vaccines 14 d before DO had no effects on MY in early lactation but reduced systemic inflammation and circulating immune cell number after DO. Administration of meloxicam at and following DO has no effects on systemic inflammation and immunity."
Production, Management, and the Environment Platform Session: 45th Discover® Conference: Dairy Cattle Lifespan: New Perspectives Platform Session Production‚ Management‚ and the Environment 2024/06/18 13:30:00 t91140 Watch 1615 Exploring variables related to survival and production in dairy replacements. 7 M. W. Overton replacement,genomic,lifetime M. W. Overton1, A. K. McNeel1 "The objective of the study was to examine relationships between variables available around first calving from the on-farm record system for production, reproduction, and survival through second lactation. Production and genomic data from the first 2 lactations from 53,333 cows first calving in 2019–2021 were extracted from 28 herds. First-lactation performance (projected 305-d milk, time to pregnancy through 250 DIM, time-to-removal and cumulative milk through 450 DIM), cumulative milk, and cumulative survival through 305 DIM of second lactation were evaluated using multivariable approaches. Milk production was evaluated using mixed models with herd, birth month, birth year, calving month, and calving year as random effects. Cox proportional hazards models were used for reproduction and survival. Logistic regression was used for cumulative survival through second lactation. For each model, fixed effects included age at first calving, age at first calving2, Dairy Wellness Profit Index (DWP$®) either as a continuous or categorical outcome, body size composite (BDC) either as a continuous or categorical outcome, calf outcome (male, female, or twins), calf status (live or dead), previous gestation length, and previous gestation length2. Herd, birth, and calving variables used as random effects within the mixed models were used as fixed effects in the other models. Age at first calving had varying effects depending upon lactation and outcome. In first lactation, older age at calving was associated with greater milk production, reduced reproductive performance, and a higher probability of removal. For cumulative results, age at first calving was not a significant predictor for either milk production or survival. Conversely, increasing DWP$ was consistently associated with greater milk production, improved reproduction, and improved survivability across both lactations. Increasing age at first calving is not a sound strategy to improve production and survivability through the first 2 lactations, but genetic improvement due to higher DWP$ ranking was associated with improved production, reproduction, and survival through these 2 lactations."
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition 2024/06/18 13:30:00 s10698                
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition 2024/06/18 13:30:00 t91405 Watch 1414 ADSA-EAAP Speaker Exchange Presentation: Breeding strategies to reduce methane emission. 1 J. Lassen methane,cattle,breeding J. Lassen1,2 "Selective breeding is a very effective way to improve traits that show quantitative genetic variance. The underlying strategy for selective breeding consists of several components. A prerequisite to do selective breeding is to have procedures that can be used to generate quality data. Preferably this is done in a continuous way at a low cost and with a minimum of labor per registration. This can be done using both indirect and direct measures of the trait that needs to be improved. Also, an effective selection procedure requires an economic incitement for the farmer to change the trait. Methane production is under some quantitative genetic control. Several studies worldwide, each based on more than 1,000 cows, have shown heritabilities higher than 20%. This means that methane production can be reduced through selective breeding. The trait to be improved will differ between countries. Some will choose to reduce methane production; others will reduce methane intensity. Methods have been developed that can be used to make large-scale registrations for the trait. Indirect approaches to reduce methane emission have mainly been based on milk sample data. This is an intriguing way to perform selection because such data are available through milk recording on each cow in many countries. It is important to continuously ensure that there is a high relationship between the trait that needs to be improved and information that is available in the milk samples. The effect of selecting for higher milk yield has a high effect on methane intensity in populations with low milk yield but limited effect in populations where the production level is higher than 6,000 L of milk per cow. The economic incitement to reduce methane emission from cattle will be visible worldwide soon. This will come both from higher income for milk and meat produced from cattle with documented lower methane emission as well as a cost for similar products if there is no documentation or a documented higher methane production. Selective breeding for reduced methane emission will be incorporated in many countries in the coming years."
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition - General 2024/06/18 13:30:00 t90848 Watch 1413 Greenhouse gas emissions from dairy cows fed best-practice diets. 2 M. Managos enteric methane emission,high-yielding cow,sustainability M. Managos1, C. Lindahl2, S. Agenäs1, U. Sonesson3, M. Lindberg1 "Dairy production faces the challenge of balancing conflicting goals: reducing greenhouse gas emissions, increasing food production, and achieving self-sufficiency within planetary boundaries. The disruptions caused by the global COVID-19 pandemic and armed conflicts have intensified these challenges, affecting the agricultural supply chain, prices, and resource availability. This study investigated milk production and methane (CH4) emissions from high-yielding dairy cows fed grass/clover silage with 3 concentrate mixtures with varying degrees of carbon footprint in the production stage. The experimental diets included a control commercial concentrate (CON), a byproduct-based concentrate (BYP) addressing feed-food competition, and a homegrown concentrate mixture (HOM) based on domestically available resources. The experimental diets were formulated to have similar theoretical nutritional value as the control and the carbon footprint of the ingredients was used as the optimization parameter. Forty-eight Swedish Holstein cows, with a milk yield of 45 ± 6.4 kg/d (mean ± SD) at the start of the experiment, blocked by parity in 2 groups, were used in a randomized complete block design with a 2-week adaptation and 7 weeks of data collection. The cows were milked voluntarily in a single-station automatic milking system. Individual daily feed intake was recorded and the GreenFeed system was used for continuous measurements of CH4. Dry matter intake (CON: 24.1, BYP: 24.6, HOM: 24.0 kg/d), energy-corrected milk yield (ECM) (CON: 47.3, BYP: 44.6, HOM: 47.1 kg/d), enteric CH4 yield (CON: 391, BYP: 374, HOM: 390 g/d), and intensity did not differ between diets. Carbon dioxide equivalent (CO2e) emissions from feed production were lower for BYP and HOM compared with CON, resulting in lower feed CO2e emission intensity per unit ECM. Our results show that rations for high-producing dairy cows can be formulated using domestically available resources and by/products without compromising milk production or milk carbon footprint."
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition - Gut physiology, fermentation, and digestion 2024/06/18 13:30:00 t91702 Watch 1170 Associations between fecal methanogens and methane emission traits in Holstein cows. 3 N. Sheybani ddPCR,methane production,methanogens N. Sheybani1, A. P. M. Assumpção1, G. Martinez Boggio1, H. M. White1, K. A. Weigel1, H. C. Mantovani1, F. Peñagaricano1 "Enteric methane, produced by methanogenic archaea in the digestive tract of cattle as the by-product of anaerobic microbial digestion, contributes to 27% of all US methane emissions. Enteric methane not only has an adverse environmental impact, but it also represents an energy loss from feed utilization by the cow. The goal of this study was to quantify abundance of methanogens in fecal samples from dairy cows with divergent methane emissions. The data set comprises measurements of methane production (MeP), net energy for lactation (NEL), and body weight (BW) from 128 mid-lactation Holstein cows in 3 different studies. We calculated residual methane intensity (RMI) by regressing MeP on NEL and metabolic BW. Within each study, we identified the cows with 10% high and low RMI (n = 30) and collected fecal samples via rectum on the last day of each study. We quantified the genus Methanobrevibacter by targeting the 16S rRNA gene using ddPCR assay with the following primers: GAACTTGAGGTCGGGAGAGG and AGGTTCGTTCCAGTTAGCCG. The genus Methanobrevibacter is the most ubiquitous and predominant hydrogenotrophic methanogen found in the foregut and hindgut of herbivores. We evaluated the association between fecal Methanobrevibacter, measured as log-transform counts, and 2 methane traits, MeP and RMI, using linear regression. Notably, the amount of Methanobrevibacter in fecal samples was negatively associated (P = 0.05) with both methane production and residual methane intensity. Overall, our findings highlight the importance of targeted approaches to unveil the link between methanogen abundance and CH4 emissions in dairy cattle."
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition - General 2024/06/18 13:30:00 t91620 Watch 1345 Effects of enteric methane inhibitors on ruminal fermentation patterns in vitro using inoculum from cows with high and low methane yield phenotype. 4 N. Stepanchenko methane,ruminal fermentation,phenotype N. Stepanchenko1, D. E. Wasson1, S. F. Cueva1, L. F. Martins1, D. W. Pitta2, A. N. Hristov1 "In vivo research has shown increased rumen butyrate concentration under inhibited methanogenesis in dairy cows. The objective of this experiment was to investigate the mechanism of butyrate concentration increase by evaluating the proportional changes of 13C enrichment of rumen VFA using uniformly labeled D-glucose (GLU13) and sodium acetate (ACET13) and 2 potent CH4 inhibitors (INH): Asparagopsis taxiformis (AT, at 0.25 and 0.5% of substrate DM), and 3-nitro-1-propionic acid (3NPA, at 0.5 and 1% of substrate DM). Four lactating Holstein cows were selected from a pool of 48 animals and 2 were designated as phenotypically (PHEN) high- (HM, 19.8 and 20.3 g CH4/kg DMI) and 2 as low-CH4-emitters (LM, 14.5 and 13.2 g CH4/kg DMI). Repeated in vitro incubations were carried out for 24 h at 39°C with TMR as substrate (at 1%, wt/vol). Data were analyzed using a MIXED procedure of SAS with INH, PHEN, dose, and interactions in the model. Total gas production was decreased (P < 0.01) on average 32 ± 8.2% by INH. Methane production decreased (P < 0.01) 96 ± 5.8% by INH versus CON. Butyrate concentration increased (P = 0.05) by 3NPA, but not AT (P = 0.61). Concentrations of other VFA were not affected (P ≥ 0.27) by INH. When GLU13 was used as a labeling substrate, 13C-enrichment of all butyrate carbons was greater (P < 0.04) for HM by 20% to 37%, and 13C-enrichment of second and third carbons of propionate tended to be lower (P < 0.06) by 9.5% and 16%, compared with LM. The INH increased (P < 0.04) 13C-enrichment of the carboxylic carbon of propionate by 20%. When ACET13 was used, the INH increased (P < 0.02) 13C-enrichment of carboxylic and second carbons of propionate by 27% and 25%, respectively. In conclusion, inhibition of methanogenesis resulted in increased 13C enrichment of propionate, which serves as an alternative H2 sync derived from pyruvate, while HM inoculum in combination with GLU13 reduced 13C enrichment of butyrate through host-microbial interaction. Microbial analysis must be conducted to identify specific species contributing to these changes."
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition - General 2024/06/18 13:30:00 t91027 Watch 1350 Effects of dietary rumen-derived microbial product supplementation on lactation performance and enteric methane emission in lactating dairy cows. 5 M. Bulnes direct-fed microbial,feed additive,sustainability M. Bulnes1, A. Celemin Sarmiento1, M. R. A. Redoy3, J. Lefler2, C. Marotz2, M. Embree2, T. H. Swartz1, M. E. Uddin3 "The objective of this study was to evaluate the effects of a rumen-derived microbial product (MP; Galaxis Frontier, Native Microbials) on lactation performance and methane (CH4) emissions in dairy cows. Thirty-four Holstein cows (10 primi- and 24 multiparous) averaging (±SD) 98 ± 37 DIM and 43 ± 13 kg/d of milk yield (MY) were enrolled in the study, which included a 2 wk covariate period and 16 wk of treatment supplementation. Cows were blocked based on parity, DIM, and MY, and randomly assigned to one of 2 treatments: control (CON, TMR + 150 g/d of ground corn; n = 17) or treatment group (MP, TMR + 150 g/d of ground corn + 5 g/d of MP; n = 17), top-dressed once a day. Milk yield, energy-corrected milk (ECM), milk components, somatic cell score (SCS), dry matter intake (DMI), and feed efficiency (FE; DMI/ECM) were monitored. Enteric CH4 emission was measured using the GreenFeed system. Data were analyzed using linear mixed models (PROC GLIMMIX) as repeated measures with covariate, treatment, week, and their interaction as fixed effects. Block and cow were random effects. Compared with CON, MP cows tended to produce greater milk (38.3 vs. 36.8 ± 0.7 kg/d, P = 0.06), had greater DMI (26.9 vs. 25.9 ± 0.4 kg/d, P = 0.04), and had greater FE (0.67 vs. 0.64 ± 0.01, P < 0.05). The covariate ECM yield and fat % interacted with treatment (P = 0.02 and P < 0.001). When ECM covariate was <30th percentile, MP cows had greater ECM yield than CON. When fat % covariate was >40th percentile, MP cows had greater fat % than CON. Conversely, MP cows had lower SCS (2.87 vs. 3.32 ± 0.2, P < 0.05) and milk urea N (13.2 vs. 14.9 ± 0.3 mg/dL, P = 0.03). Treatment did not affect daily enteric CH4 production (g/d per cow); however, MP supplementation decreased enteric CH4 yield (CH4/DMI) by 11.8% (P < 0.001) and intensity by 7.1% (CH4/MY; P < 0.05) and 5.7% (CH4/ECM; P < 0.05). In conclusion, supplementing MP may reduce CH4 yield and intensity by improving feed efficiency and energy-corrected milk yield without increasing daily CH4 production."
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition - Gut physiology, fermentation, and digestion 2024/06/18 13:30:00 t91160 Watch 1553 Investigating rumination time, microbial populations, and volatile fatty acids to uncover predictive methane emission markers in lactating dairy cattle. 6 A. C. B. Johnson rumination,microbiome,methane A. C. B. Johnson1, K. Narayan1, A. Castaneda1, T. Webb1, J. Bender1, L. Baker1, S. Rassler1, A. Post1, R. Kashyap1, N. Indugu1, D. Pitta1 "Rumination time (RT) is a heritable trait in cattle that can be tracked on farm by precision technologies. We have previously shown that we could detect 2 distinct clusters of animals based on high RT (H-RT) and low RT (L-RT), and the current study expands upon that preliminary finding to determine if these RT phenotypes can be linked to methane (CH4) emissions and thus serve as a marker for identifying dairy cows with high and low CH4-yield phenotypes. We aim to gain a better understanding of the mechanistic connectivity between animal behavioral activities with rumen microbiota and CH4 emissions. Over the course of one year, 159 animals were enrolled to the study including a 4-wk training/adaptation period, with 2 wk of RT (Aficollar, Afimilk Ag. Cooperative Ltd.) and CH4 emissions sampling (GreenFeed, C-Lock Inc.), and 1 week of 16S bacterial and VFA surveying at 2 time points (2 and 8 h postfeeding). Animals with a minimum of 15 CH4 readings covering a minimum of 19 h of the day were retained in the dataset (n = 87). All RT data were used to cluster the animals into 2 groups and an H-RT (n = 51) and L-RT (n = 36) phenotype were identified covering the spring, summer, and fall seasons. Over the entire year, RT was negatively correlated with CH4 emissions, and particularly in summer and fall seasons (P < 0.01 and P < 0.05, respectively). Over all the seasons, Bacteroidales, 2 Paraprevotellaceae, and a Christensenellaceae genera and isobutyrate percent were negatively correlated (P < 0.05) to RT but valerate percent was positively correlated (P < 0.05). Bacterial richness was increased at 2 h postfeeding compared with 8 h postfeeding, but Fibrobacter increased at 8 h post feeding as expected. The L-RT phenotype differed significantly (P ≤ 0.01) from H-RT in daily average RT (14.4 vs. 20.8 min/h), CH4 emissions (284 vs. 255 g/d), acetate (58.1 vs. 60.1%), propionate (22.9 vs. 25.2%), and A:P ratio (2.75 vs. 2.41). The results of this study indicate that RT could be used to estimate CH4 effectively in the summer and fall seasons."
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition - General 2024/06/18 13:30:00 t91360 Watch 1633 Effects of dose, diet, and supplementation period on the methane-mitigating efficacy of feed additives: A meta-analysis. 7 L. F. Martins methane,mitigation strategy,diet composition L. F. Martins1, S. F. Cueva1, D. E. Wasson1, C. V. Almeida1, C. J. Eifert1, M. B. de Ondarza2, J. Tricarico3, A. N. Hristov1 "The objective was to quantify the CH4-mitigating efficacy (MEff) of anti-methanogenic feed additives (AMFA) in dairy cattle when accounting for the effects of dose, diet nutrient composition, and supplementation period (SP). Publications from 1988 through 2022 (n = 103) with 200 treatment and control mean comparisons were considered for analysis. Selected AMFA were macroalgae, 3-nitrooxypropanol (3-NOP), nitrate, lipids, and plant secondary compounds (PSC). Response variables were daily CH4 emission (CH4D, g/d), yield (CH4Y, g/kg dry matter intake; DMI), and intensity (CH4ECM, g/kg energy-corrected milk). Dose (mg or g/kg of DMI), forage-to-concentrate ratio (F:C), diet nutrients (EE, NDF, ADF, and starch; as % of DMI), and SP (d) were used as continuous explanatory variables. Relative mean differences (treatment effect as % of control) were analyzed by robust variance estimation models. Data for macroalgae were limited and responses for studied species were contrasting but, overall, this class of AMFA did not affect CH4emissions (P ≥ 0.15). 3-NOP decreased CH4 emissions by up to 32% ± 2.9% (P < 0.01; max response for CH4ECM). 3-NOP CH4D and CH4Y MEff increased by increasing starch and decreasing F:C or ADF (P ≤ 0.10). Nitrate supplementation decreased (P ≤ 0.01) CH4 emissions by up to 18% ± 1.6% (max response for CH4D). Nitrate CH4D MEff increased by increasing NDF, and SP (P ≤ 0.10). Nitrate CH4Y and CH4ECM MEff increased by increasing its dose (P ≤ 0.06). Lipids decreased CH4 emissions by up to 14% ± 1.7% (max response for CH4ECM). Lipids CH4Y MEff increased by increasing EE and starch but decreased with increasing ADF (P ≤ 0.09). PSC decreased CH4Y by up to 8%, and its CH4Y MEff was increased by increasing diet fiber components, and SP (P ≤ 0.08). Overall, increasing diet fiber and decreasing starch were positively associated with the MEff of nitrate, but negatively associated with the MEff of 3-NOP and lipids. SP was positively associated with the efficacy of nitrate, lipids (CH4ECM), and PSC. Variability in the MEff of AMFA can be explained by differences in dose, diet nutrients, and SP."
Ruminant Nutrition Platform Session: Challenges and Opportunities for the Impactful Implementation of Greenhouse Gas Mitigation Strategies Platform Session Ruminant Nutrition - Gut physiology, fermentation, and digestion 2024/06/18 13:30:00 t91215 Watch 1647 Evaluation of animal performance, energy requirements, and enteric methane emissions in lactating dairy cows ranked by residual methane production. 8 V. Carneiro de Souza greenhouse gas,energy requirement,model V. Carneiro de Souza1, P. Niu2, A. Schwarm2, A. Guinguina3,5, T. Yan4, A. R. Bayat5, M. Kreuzer6, P. Lund7, E. Kebreab1, P. Huhtanen5 "The aim of this study was to compare animal performance, enteric methane (CH4) emissions, metabolizable energy requirement for maintenance (MEm), and the efficiency of energy utilization (kl) in dairy cows classified into low- (low-residual CH4 [RCH4] < − 14.2 g/d), medium- (medium-RCH4; −14.2 to 14.5 g/d), and high-RCH4 (high-RCH4 > 14.5 g/d) groups. We compiled a database of 1,060 individual records of DMI, milk yield (MY) and composition, and enteric CH4 emissions from 37 published and unpublished studies conducted in respiration chambers by research entities in Europe. Residual CH4 was calculated as observed CH4 − predicted, being CH4 predicted from DMI (kg/d) and BW (kg). The lme4, lmerTest, and emmeans R packages were used for model development, and the experiment and diet within the experiment were included as random factors. Animal performance and enteric CH4 emissions were compared among RCH4 groups using the Tukey test. The MEm and kl were derived from the linear regression of milk energy output corrected for zero energy balance (MJ/kg of BW0.75) against metabolizable energy intake (MJ/kg of BW0.75) and RCH4 ranking. There were no significant differences between the low-RCH4 and high-RCH4 groups in animal performance (DMI, MY, ECM, and milk protein content), except for milk fat content, which was greater (P < 0.05) for the high-RCH4 group. However, absolute CH4 production, CH4 yield, and CH4 intensity were lower (P < 0.05) for the low-RCH4 group compared with the medium- or high-RCH4 groups. The MEm (MJ/kg of BW0.75) was lower (P < 0.01) for the low-RCH4 group (0.43 ± 0.021) compared with the high-RCH4 group (0.48 ± 0.025) and tended (P = 0.05) to be lower than the medium-RCH4 group (0.47 ± 0.023). However, kl was not different (P > 0.05) among the RCH4 groups (average = 0.65 ± 0.011). In conclusion, RCH4 has the potential to be used as a phenotype for selecting cows with reduced enteric CH4 emissions. Despite the energy savings due to the lower MEm and enteric CH4 emissions in the low-RCH4, no benefits in performance were observed compared with the high-RCH4 group."
Teaching Platform Session: The Scholarship of Teaching and Learning 101: Demystifying Using the Classroom for Research Platform Session Teaching/Undergraduate and Graduate Education 2024/06/18 13:00:00 s10700                
Teaching Platform Session: The Scholarship of Teaching and Learning 101: Demystifying Using the Classroom for Research Platform Session Teaching/Undergraduate and Graduate Education 2024/06/18 13:00:00 n9110 Watch 9008 Getting started with SoTL: Simple steps to getting the most out of teaching 1 Jillian Fain Bohlen      
Teaching Platform Session: The Scholarship of Teaching and Learning 101: Demystifying Using the Classroom for Research Platform Session Teaching/Undergraduate and Graduate Education 2024/06/18 13:00:00 n9111 Watch 9009 A dairy scientist’s journey to evidence-based learning 2 Liz Karcher      
Teaching Platform Session: The Scholarship of Teaching and Learning 101: Demystifying Using the Classroom for Research Platform Session Teaching/Undergraduate and Graduate Education 2024/06/18 13:00:00 t91492 Watch 1415 Modern publishing tools for modern science: An open-source web app of the 2021 Nutrient Requirements of Dairy Cattle. 3 D. J. Innes Shiny,ration,teaching D. J. Innes1, B. G. Fieguth1, J. P. Cant1 "Recent advances in free, open-source tools for publishing content from R and Python (e.g., Shiny and Quarto from Posit, PBC) provide us with an opportunity to modernize research and education materials. Shiny is a development framework for building web apps using syntax familiar to a typical R or Python user and is particularly useful for adding interactivity to otherwise static visual representations of data. Shiny also integrates with Quarto, which is an easy-to-use publishing framework for creating books, websites, slides, manuscripts, etc. It is a great option for developing modern, reproduceable training material, including features to showcase the underlying code. However, there might be some resistance to change; for example,we are still constrained to present at many conferences using only Microsoft PowerPoint, but our aim is to demonstrate what else is possible. For example, we recently converted the R code of the latest Nutrient Requirements of Dairy Cattle (NASEM, 2021) into a Python package to use in precision nutrition modeling, which also allowed us to write a simple “Shiny for Python” ration balancing app for teaching dairy nutrition. The main objectives for developing this web app were to simplify access to the software (e.g., NASEM 2021 software only available on Windows) and to allow for easy customization of the information that students interact with. We added buttons that would load scenarios based on different animal and diet inputs. These preloaded scenarios were useful for demonstrations and for loading assessment scenarios with a known dietary issue that the students were asked to re-balance using concepts taught in class. The app recalculates a “snapshot” of model outputs as the user modifies diet inputs, providing instant feedback. It also displays annotated outputs and generates a comprehensive report to download. By the end of semester, students were able to load custom feed libraries and evaluate commercial dairy rations. This interactive, scenario-based learning was appreciated by students. The app and its code are publicly available on GitHub, fostering a collaborative environment for ongoing development."
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 s10596                
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 t90928 Watch 1569 The way we look at the membrane for protein fractionation. 11 B. R. Parjikolaei mechanistic understanding,membrane,protein B. R. Parjikolaei1 "Membrane technology plays a crucial role in the dairy industry, enabling the separation of valuable components while preserving their nutritional integrity. However, the inherent limitations of membrane processes necessitate further research to address the challenges and optimize their performance. Our research focuses on membrane filtration and protein fractionation to enhance functionality and reduce the environmental impact of specialized dairy ingredients. One key aspect of our research has been to untangle the fundamental mechanisms that govern membrane performance. By identifying critical process parameters e.g., pH and concentration, and understanding the complex interplay between feed-membrane properties and separation efficiency we have gained valuable insights into optimizing membrane processes in a more predictable way. Recognizing that protein fractionation is a dynamic process, we have also explored the challenges of mimicking industrial-scale membrane processes in laboratory-scale systems and the feasibility of in-line measurement of separation mechanisms and fouling formation in real-time. Additionally, we have devoted significant attention to the Cleaning-in-Place (CIP) protocols and exploring the impact of CIP on membrane properties. In the interest of sharper selectivity in protein fractionation, we have also studied the feasibility of manipulating driving forces to modify the separation mechanisms, producing protein fractions with enhanced purity and functionality, paving the way for the development of innovative dairy ingredients. These efforts enable us to gain a comprehensive understanding of dynamic aspects of the protein fractionation, optimizing the CIP, membrane performance, and lifespan while producing specialized dairy ingredients that have improved functionality and lower environmental impact."
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 t92008 Watch 1570 How research and innovation turn into dairy products in your home. 12 J. Ortega milk fat,innovation,functionality J. Ortega1,2 "The performance and nutritional value of butter and other butter-derived products is linked to the microstructural features of the fat. At Arla Foods, we always strive to develop innovative solutions to optimize and improve the structure and functionality of our dairy products such as butter. In this presentation, we will go over the research aimed to study the crystallization and shear-induced structure formation of fat blends composed of anhydrous milk fat (AMF) and rapeseed oil (RO). The investigations were centered around different shear rates applied to a 500 g mass of AMF and 20 wt/wt% RO blends. Structural build-up and breakdown were demonstrated by solid fat content determination and large deformation rheology. However, the effects of shear forces on structural formation were found to be greater in the 20% RO blends. The incorporation of liquid oil into the solid milk fat structure was found to lower the melting behavior depending on the shear force, which affects the internal oil binding. Furthermore, a procedure to investigate the crystallization behavior of milk fat globules (MFGs) was developed by confocal Raman microscopy (CRM). Results showed crystallization patterns where triacylglycerol crystals are positioned around the inner membrane surface of the milk fat globule membrane. CRM was also used to identify solid from liquid fat domains within MFGs, which eliminated the effects of interference patterns observed by polarized light at the spherical lipid membrane. In conclusion, we gained insight into how we can study the performance of milk fat and rapeseed oil blends, by determining structural parameters that can potentially be fine tuned by processing to obtain the best dairy products in our market."
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 t90565 Watch 1563 The dairy matrix and calcium bioavailability. 2 H. C. Bertram fermentation,prebiotic,bone health W. He1, Z. Xie2, N. K. Wittig1, L. F. Zachariassen2, H. J. Andersen2, H. Birkedal1, D. S. Nielsen2, A. K. Hansen2, H. C. Bertram1 "Objectives: Being rich in calcium, dairy products provide an excellent food matrix to prevent bone loss in postmenopausal women, but recent research supports that the inclusion of dietary fibers also exerts this capability. The milk matrix (e.g., casein micelles) is likely to benefit the controlled release of calcium into the intestinal lumen, thereby increasing calcium fractional absorption. Both yogurt and dietary fibers may improve bone homeostasis in postmenopausal women by modulating gut microbiota. However, the mechanisms underpinning these effects are scarce. This study aimed to compare the effects of milk, yogurt, and yogurt-inulin combination on gut-bone associations. Methods and results: A 6-week dietary intervention study was conducted in ovariectomized rats. Calcium content, inulin, and milk/yogurt addition were the main differences in composition among the diets. Milk supplementation did not influence bone mineral density (BMD) or bone mineral content, femur mechanical strength, or femoral microstructure as compared with the positive control receiving a similar calcium dose from a calcium carbonate source, whereas yogurt supplementation significantly increased spine BMD. The serum metabolome revealed that yogurt also modulated endogenous glycine-related pathways with reduced concentrations of serum glycine, serine, and threonine. No additive effects of yogurt and inulin were observed for the examined bone mineralization parameters. Microbiota analysis showed that increased lactobacilli and reduced Clostridiaceae members in the gut of the yogurt-supplemented group were linked with an increased spine BMD, whereas increases in some bacteria (Bifidobacterium pseudolongum, Turicibacter, Blautia, and Allobaculum) and gut short-chain fatty acids in the yogurt-inulin supplemented group were not reflected in measured bone parameters. In conclusion, the present study demonstrates that yogurt intake changed the gut microbiota composition and serum metabolites related to glycine-related pathways with a concomitant increased spine BMD, suggesting that yogurt as a vehicle is superior to milk in terms of securing optimal conditions for bioaccessibility of calcium to enhance bone mineralization."
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 t90806 Watch 1564 Sustainable dairy: Effect of feed additives on milk composition and functionality. 3 N. A. Poulsen milk,3-nitrooxypropanol,nitrate G. M. S. Lokuge1, M. Maigaard2, N. I. Nielsen3, L. B. Larsen1, P. Lund2, L. Wiking1, N. A. Poulsen1 "Mitigating methane emissions through specific feed practices and feed additives are intensively studied, whereas the possible effects on milk quality are less examined. We explored the effect of antimethanogenic feeding strategies on milk quality and functionality with a focus on supplementation of 3-nitrooxypropanol (3-NOP), nitrate, and whole-cracked rapeseeds in several animal trials and farm experiments. In the first animal experiment, 48 lactating Danish Holstein cows were allocated to 8 different rations (2 levels of cracked rapeseed, +/− nitrate, +/− 3-NOP) over 6 periods of 21 d each, according to an incomplete Latin square design. In total, 288 milk samples were collected and analyzed for detailed milk quality traits. The trial confirmed the methane reducing effect of the tested feed additives. Furthermore, the individual and combined use of whole-cracked rapeseeds, nitrate, and 3-NOP affected the milk composition to varying degrees, and especially supplementation of whole-cracked rapeseeds altered milk fatty acid (FA) composition by decreasing the proportion of saturated FA and increasing the proportion of unsaturated FA. In contrast, no additive effects of fat, nitrate, and 3-NOP were observed on milk protein and mineral composition, whereas individual fat supplementation largely altered protein composition. Milk composition changes by nitrate and 3-NOP supplementation were relatively minor. However, feeding nitrate increased riboflavin and nitrate concentrations in milk, whereas 3-NOP increased vitamin B12 concentration. In addition, large-scale butter production was performed using milk from cows fed 3-NOP. 3-NOP butter had higher proportions of short- and medium-chain FAs, which slightly affected the physical properties of butter. Use of 3-NOP has also been tested across different breeds where differences in milk FA composition were observed, suggesting that breeds differ in their response to 3-NOP. Implementation of the different methane emission mitigating strategies is currently being tested on commercial farms and targeted milk analyses are conducted to ensure that no impairment of milk quality is at play."
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 t90960 Watch 1565 Innovative cheese products by extrusion. 5 L. Ahrne extrusion,cheese,functional property L. Ahrne1 "The development of dairy products with innovative structures, which can offer new experiences to consumers, is of great importance to the dairy industry. A unique characteristic of the world-popular mozzarella cheese is its fibrous structure, which is traditionally created during the cooking-stretching process. During this process, the shear forces applied to the cheese curd during kneading and extrusion play a key role in the final structure of the cheese. Extrusion technology has gained industrial interest to texturize plant proteins, whereas applications to dairy proteins to create cheese are still limited. New insights into extrusion of cheese curds and the relationship between extrusion parameters, extruded cheese microstructure and its functional properties will be presented. By combining confocal laser scanning microscopy and X-ray micro-tomography techniques, and low field nuclear magnetic resonance, a better understanding of the structure of the protein, fat, and serum phase, as well as salt and water distribution, and anisotropic characteristics of the structure can be obtained. Application of high-shear to the curds using a twin-screw extruder show that extrudates with a variety of characteristics can be produced by modifying the extrusion parameters and/or curd properties. Controllable extrusion parameters—heating and cooling temperatures—are crucial to create fibrous curd structures. Exit temperature, residence time, and specific mechanical energy were selected as promising indicators for a better understanding of the extrudate properties, since these can comprehensively summarize the influence of multiple controllable parameters and their interactions. Modifications of the protein matrix of curds shows significant impact on the extrusion process and consequently on meltability and oiling off of the extruded cheese. Overall, the results show the potential to create a variety of extruded cheese products by exploring the relationships between extrusion parameters and curd composition. The knowledge generated provides new knowledge to improve equipment design and to produce structured cheese products with customized behavior."
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 t90980 Watch 1566 Healthier milk fat fractions through cow feeding or by volatility-based enrichment process. 6 L. Wiking milk fat,medium-chain fatty acid,n-3 (omega-3) fatty acid L. Wiking1, S. S. Mathiesen1, L. B. Larsen1, N. A. Poulsen1 "Milk fat contains several fatty acids (FA) with potential health benefits. This presentation will focus on ways to increase n-3 FA and medium-chain fatty acids (MCFA) in milk. Feeding dairy cows with grass in the field has great potential, as the dairy cow is supplied with its supply of energy and nutrients through grazing, either entirely or partly. This can contribute to sustainable and economically profitable milk production, while at the same time changing the milk’s nutritional profile in a positive direction in relation to human health. In one project we compared fat composition from 2 herds, one practicing an exclusive grass feeding strategy and the other feeding high levels of grass, but not exclusive, providing bulk milk from an organic and a conventional milk line, respectively. Exclusive grass feeding resulted in the most favorable n-3/6 ratio compared with other grass feeding regimens, and this milk also contained significantly more vitamin E. Moreover, we explored the growing practice of feeding fresh grass within the barn and how this affects milk quality. MCFA have been shown to be linked with health benefits in humans, such as improving insulin sensitivity and reducing appetite, which may be useful in managing diabetes and obesity. The content of MCFA in milk can be elevated by feeding high-starch diets or choosing milk from Jersey cows. Our approach to significantly increase the MCFA in milk or milk fractions was to use a volatility-based enrichment process for short-chain fatty acids and MCFA conducted by short path distillation. Here, a 2-fold increase in C8–C12 proportions of distillates compared with native milk fat, corresponding to 21% of the total fat, was obtained. The highest increase was for C8:0. Vitamin E was also greatly enriched in the distillate, from 2.5 mg/100 g fat in native milk fat to 47 mg/100 g fat in the distillate. This novel distillate may hold significant metabolic advantages."
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 t90924 Watch 1567 Lacprodan bLG-100: An enabler for advances in controlling taste, flavor, and functionality in ready-to-drink beverage applications. 8 S. B. Nielsen whey protein beverage,taste and flavor,protein functionality S. B. Nielsen1 "Lacprodan bLG-100 is a novel ingredient from Arla Foods Ingredients that represents a new era in providing large product volumes of a highly pure and previously expensive β-lactoglobulin source high in leucine and essential amino acids. Beyond nutritional value the emergence of β-lactoglobulin has enabled a cascade of further development in new process and application opportunities that build and extend on decades of academic and industrial research into whey protein stability, aggregation, and functionality. This talk showcases how some of the molecular insights obtained from studying β-lactoglobulin via continued research in both an industrial setting and in collaboration with university partners has enabled the development of new and emerging ingredients, processes, and applications ranging to molecular aspects of taste improvements in acid (astringency, acidity) and neutral (off-flavor) ready-to-drink beverage applications, as well as highly dense protein aggregates with superior heat stability and minimal viscosity contribution in both process and application, which make them particularly relevant in high-protein beverages."
ADSA Dairy Foods Division International Partnership Program (IPP) Symposium: Dairy Research in Denmark - Focus on Sustainability and Functionality Symposium ADSA International Partnership Program Symposium - Dairy Research in Denmark *invitation only 2024/06/19 09:30:00 t91165 Watch 1568 Exopolysaccharide-producing lactic acid bacteria and texture of acid dairy gels. 9 V. Vojinovic fermented milk,exocellular polysaccharide,texture V. Vojinovic1 "Many lactic acid bacteria (LAB) produce exocellular polysaccharides. These macromolecules are known to play an important role in the texture of the dairy products produced through use of these bacteria. Despite the ubiquity within bacteria species (and LAB in particular), and their relevance to the dairy industry, knowledge about the mechanisms through which bacterial exocellular polysaccharides modulate the texture of dairy products is limited. A common approach to leveraging the texturizing potential of exocellular polysaccharides produced by different strains of LAB is to screen for the texturizing strain candidates and the optimal starter culture blends. The world’s largest LAB culture collection, together with internally developed robotic-based high-throughput screening techniques have enabled Novonesis (previously Chr. Hansen) to develop and market well-recognized highly performant texturizing starter cultures for fermented dairy applications. However, understanding the role of exocellular polysaccharides in the development of texture in acid-based dairy gels is expected to enable a shift from screening-based to rational, targeted development of starter cultures. This presentation will address the following topics: (i) current knowledge of the role of exocellular polysaccharides in the development of the texture of acid-based dairy gels; (ii) development and use of exocellular polysaccharide-producing cultures in fermented milk: current approaches and challenges; and (iii) future prospects."
ADSA Interdisciplinary Symposium: Application of Artificial Intelligence to Dairy Systems Symposium ADSA Interdiscipline Symposia 2024/06/18 13:30:00 s10696                
ADSA Interdisciplinary Symposium: Application of Artificial Intelligence to Dairy Systems Symposium ADSA Interdiscipline Symposia 2024/06/18 13:30:00 t92171 Watch 1360 Advancing precision dairy farming: Challenges and opportunities in data integration and methodological frameworks. 1 M. Hostens artificial intelligence,data-driven dairy,precision dairy M. Hostens1,2 "Precision dairy farming (PDF) encompasses advanced technologies for automatic, real-time monitoring of cow welfare, health, environmental impact, and production, prioritized globally to meet agricultural policy goals. Precision dairy farming facilitates the transition toward resilient, sustainable dairy farming, widely adopted in the industry. Technologies like milk robots, heat detection sensors, and new sensor technologies gather production and health data, while automated weight scales and imaging technologies are implemented. Real-time emission monitoring links farm management to emission rates, and wireless sensors and drones aid precision agriculture for crops and the environment. Integrating these data remains a challenge, yet offers numerous opportunities, including precision phenotyping, digital twin creation for simulation modeling, and genomic prediction of precision phenotypes. However, challenges such as data integration difficulties, data ownership, privacy, and security issues hinder full exploitation of dairy data by artificial intelligence. There is also a lack of a clear methodology in dairy science to analyze PDF data, with existing approaches scattered across research organizations. Considering the importance of sustainable food production and the scattered organizational data landscape, research should focus on developing methodological frameworks for heterogeneous dairy data. These frameworks aim to enable access to valuable agricultural data across different locations, addressing data heterogeneity through definitions and ontology mapping. These frameworks will encourage data reuse, stimulate the use of real-time integrated PDF data, and facilitate evidence-based decision-making in dairy farming."
ADSA Interdisciplinary Symposium: Application of Artificial Intelligence to Dairy Systems Symposium ADSA Interdiscipline Symposia 2024/06/18 13:30:00 t92134 Watch 1361 Opportunities of artificial intelligence (AI) in enhancing quality control of the dairy food supply chain. 2 C. Qian digital dairy,computer modeling,machine learning C. Qian1 "The ever-changing landscape of artificial intelligence (AI), particularly in computer vision and natural language processing, has lowered the barrier for developing and using AI tools. With increasingly transformative and accessible AI toolkits, more opportunities began to emerge throughout the dairy food supply chain to control the quality of dairy products more stringently and reliably, and therefore prevent food waste and loss. This presentation will cover 3 main areas where AI can benefit the quality control of dairy food supply chain, which are (1) diagnosis of critical factors and practices for decision-making in control strategies, (2) real-time prediction and monitoring of microbial contamination in the dairy product or dairy production environment, and (3) optimization of existing risk assessment tools with more data supply. Currently, we are at a phase where some of these technologies are developed for specific tasks in quality control, and yet, digitalizing the entire dairy food system would require much larger-scale effort and design thinking into investigating the connectivity between various tools at different stages of supply chain as well as addressing issues such as data privacy when sharing sensitive data across stakeholders or platforms. An ideal system will be envisioned and proposed to conclude this presentation, with highlights on currently available tools and emergent areas for future research needs."
ADSA Interdisciplinary Symposium: Application of Artificial Intelligence to Dairy Systems Symposium ADSA Interdiscipline Symposia 2024/06/18 13:30:00 t92197 Watch 1362 Generative artificial intelligence tools in journal article preparation: A preliminary catalog of ethical considerations, opportunities, and pitfalls. 4 R. R. White artificial intelligence (AI),large language model (LLM),journal article R. R. White1 "Public launch of large language models (LLM) such as ChatGPT has catalyzed considerable discourse about the role of generative artificial intelligence in scientific publishing. The goal of this work is to review viewpoints on LLM use in scientific writing and to explore strengths and weaknesses of contemporary LLM for journal article preparation. Scientific articles hold a unique place in humanity’s knowledge structure as a primary information source. Primary information sources are trusted above secondary and tertiary information sources due to quality control practices to minimize biased, inaccurate, or misleading information. As such, protecting the fidelity of journal articles as a primary information source is critical for continuity of humanity’s reliance on scientific findings as an underpinning for truth or reality. Most LLM are trained on a diversity of human-generated material, much of which is classified as secondary or tertiary information. Thus, use of existing LLM for unsupervised generation of scientific articles is unlikely to yield quality results, though evolution of LLM derived specifically for this purpose is likely inevitable. Careful use of current LLM in journal article preparation can serve as an initial exploration of this long-term possibility. Laboratory-specific procedures like careful prompt engineering can help support coupled human-LLM strategies wherein human attention is devoted primarily to the scientific content, while the LLM can support clarity, consistency, and completeness of language or presentation. Although debate exists surrounding the ethics of LLM use, the responsibility for the content of scientific articles, their interpretability, and accuracy lies with the authors. In complement to this responsibility, the peer-review process is intended to ensure quality control before information is broadly released. Maintenance of human insight and standards within the publication process is essential to maintain high ethical standards, though LLM can help alleviate communication challenges, allowing humans to focus more attention and energy to the science."
ADSA Interdisciplinary Symposium: Application of Artificial Intelligence to Dairy Systems Symposium ADSA Interdiscipline Symposia 2024/06/18 13:30:00 t92133 Watch 1363 Smart cows, smart farms: Unleashing the potential of artificial intelligence in the dairy sector. 5 J. M. Bewley artificial intelligence,machine learning,technology J. M. Bewley1 "Artificial intelligence, along with buzzwords like machine learning, deep learning, big data, is being applied in the dairy industry in multiple forms. This term generally refers to the use of computing technology to mimic and automate complex tasks normally accomplished by the human brain. These techniques are being applied within the dairy industry to process time-series data from wearable, vision-based, and in-line milk technologies. Results are often incorporated into decision support systems to assist dairy producers make individual animal or group-based decisions. Artificial intelligence can be applied to process machine data (i.e., images or raw accelerometer data) into meaningful biometrics (i.e., objective scores or rumination time). Or, it can be applied to using biometric data to make specific intervention recommendations. Compared with traditional statistical techniques, artificial intelligence often employs more “black box” strategies without a statistical equation to help interpret how results were derived. Unfortunately, this provides an opportunity for overmarketing how artificial intelligence is being employed within an on-farm system. Further, for machine vision systems to work properly and continue to improve, new biological ground truth must be provided to the system. Ethical concerns exist centered around how much power machines should have in working with animals. Despite these concerns, what artificial intelligence is accomplishing on farms today already is groundbreaking and exciting. As dairy farms continue to grow and artificial intelligence techniques continue to advance in all industries, the impact of artificial intelligence on dairy farms will continue to grow."
ADSA Interdisciplinary Symposium: Application of Artificial Intelligence to Dairy Systems Symposium ADSA Interdiscipline Symposia 2024/06/18 13:30:00 n9125 Watch   Panel Discussion 6        
ADSA Southern Branch Symposium: Seasonality in the Dairy Production System Symposium ADSA Southern Branch Symposium 2024/06/19 09:15:00 s10737                
ADSA Southern Branch Symposium: Seasonality in the Dairy Production System Symposium ADSA Southern Branch Symposium 2024/06/19 09:15:00 t91081 Watch 1500 Seasonality of milk production and composition. 1 M. A. C. Danes Brazilian dairy,genomic,cosinor M. A. C. Danes1, J. P. A. Rezende1, C. R. Monteiro1, V. A. Oliveira1, L. H. Silva1, J. H. Carneiro2 "The existence of an endogenous rhythm that affects biological phenotypes, such as milk production and composition throughout the year, is well known and reported. Quantifying the proportion of the observed variation in a trait that is due to endogenous rhythm allows for better data interpretation and management decisions. It is also important to understand the factors that can influence the endogenous rhythm so that it is possible to include these effects in a rhythm prediction model. For instance, one of the factors that appears to influence the seasonal rhythm is the photoperiod (both the absolute number of hours of light in the day and the day-to-day variation in this number). Data from the northern hemisphere have already demonstrated this effect by comparing regions at different latitudes. The evaluation of this behavior in different regions of the southern hemisphere can demonstrate more clearly the effect of photoperiod, as well as suggest other important factors affecting seasonality. Therefore, we explored different databases containing milk production and composition data from Brazil to conduct cosinor-based rhythmometry analyses. First, we analyzed milk composition data of the last 10 years from the national milk market database, grouped by region, to evaluate the effect of location (i.e., latitude) on seasonal rhythm. Next, we used individual cow data to evaluate not only the rhythm itself, but also the effects of breed, days in milk, location, and environmental temperature on the endogenous rhythm. For this analysis, we accessed data from Ideagri, a herd management software, from Instituto Clinica do Leite, a milk analysis laboratory, and from 2 breeders’ associations, Holstein and Girolando (Gyr × Holstein crossbred). We then used data from Sebrae, a nonprofit private entity promoting sustainable and competitive development of small businesses, to evaluate the effect of herd structure and economic factors (milk price and production cost) using herd-level data from Minas Gerais state. Finally, we used individual cow data from 3 herds in Paraná state to evaluate the effects of genomics on seasonality. Results from these analyses are presented and discussed."
ADSA Southern Branch Symposium: Seasonality in the Dairy Production System Symposium ADSA Southern Branch Symposium 2024/06/19 09:15:00 t91359 Watch 1501 Seasonality of reproduction. 2 P. J. Hansen heat stress,reproduction,seasonality P. J. Hansen1 "Depressed reproduction during warm periods of the year remains a limitation to optimal dairy production in most regions of the world. Using US records from DHIA, Guinn et al. (J. Dairy Sci. 101:11777) estimated that conception rate declines from 42.0% in winter to 32.4% in summer in the Southeast United States, from 41.1% to 37.5% in the Midwest United States, and from 42.0% to 37.5% in the Northeast United States. Several temporal trends are likely to interact to cause geographic-specific changes in the magnitude of seasonal variation in reproduction. Among those that will tend to exacerbate seasonal variation in reproduction are global climate change, which will increase the magnitude of heat stress, and increased milk yield, which will make cows more sensitive to heat stress. Trends that are anticipated to alleviate seasonal variation in reproduction include more widespread adoption of housing systems that provide effective cooling to cows during periods of heat stress as well as development of genetic strategies to make cows more resistant to the deleterious consequences of heat stress. There are also physiological strategies that can be used to enhance reproduction during heat stress including timed artificial insemination and embryo transfer. In addition, work continues to develop nutritional strategies to mimic cellular damage associated with hyperthermia during heat stress. It should be recognized that increasing reproductive function during heat stress could change seasonal calving patterns. A positive result could be a more consistent milk supply throughout the year. Negative consequences include more cows being in early and mid lactation during the hottest periods of the year and increased risk of adverse programming of fetal development. Thus, efforts to improve reproduction during heat stress should be carried out in tandem with efforts to reduce other effects of heat stress on cow function."
ADSA Southern Branch Symposium: Seasonality in the Dairy Production System Symposium ADSA Southern Branch Symposium 2024/06/19 09:15:00 t91831 Watch 1502 The relationship between birth season and longevity of dairy cows. 3 I. M. Toledo season of birth,longevity,dairy cow I. M. Toledo1, L. Cattaneo2, J. E. P. Santos1, G. E. Dahl1 "Longevity of dairy cows is defined as the length of the animal’s life or as the length of productive life, which is determined by either culling decisions made by the producer or death of the animal. Culling decisions are primarily driven by economic considerations. Therefore, dairy replacement management decisions largely determine the average productive life of dairy cows. In addition to economic consequences, dairy cow longevity is associated with the environmental footprint of the industry and welfare; thus, short productive life has environmental and social consequences, which are inversely associated with dairy sustainability. The ability of dairy farmers to keep their cows for longer could positively enhance the economic performance of the farms, by having a higher proportion of mature cows in the higher producing groups, reducing the environmental footprint of the milk production, and overall helping to justify the sustainable use of animals for food production. Multiple studies have documented that seasonal changes affect health, behavior, and performance of dairy cows throughout their life cycle. Management adjustments to decrease exposure to high temperatures during the hot months of the year give farmers the opportunity to decrease culling risk factors and possibly increase cow productive life. Recent analysis of seasonal records indicates that cows still on the farm in lactation 5 to 8 were more likely to be born in a cool season versus a hot season. Indeed, about 66% of longer-lived cows were born under cool conditions. This has implications for culling decisions even early in life. Birth in a cool season will increase the length of herd productive life and decrease the number of cows sold or dead during the first 4 lactations. A better understanding of the relationship between birth seasons and dairy cow longevity is an alternative to help farmers create opportunities to make management adjustments to possibly increase productive life in dairy herds. Increases in dairy cow productive life associated with birth season can possibly positively impact the dairy industry."
ADSA Southern Branch Symposium: Seasonality in the Dairy Production System Symposium ADSA Southern Branch Symposium 2024/06/19 09:15:00 t91400 Watch 1503 Nutritional challenges and opportunities in seasonal grazing systems. 4 M. Dineen pasture,milk production,environmental emission M. Dineen1 "In pasture-based systems, the diet of the cow can comprise almost completely human-inedible ingredients resulting in a large contribution to net food production. High pasture inclusion levels can support resilient family-farm incomes and an animal welfare friendly image while also increasing concentrations of beneficial nutrients in milk including n-3 polyunsaturated fatty acids, vaccenic acid, and conjugated linoleic acid. Growing environmental challenges such as greenhouse gas emissions, nitrogenous losses to air and groundwater, and loss of natural ecological habitats will require pasture-based systems to adapt and innovate. Increasing animal productivity is an effective strategy to reduce the intensity of environmental emissions (i.e., per unit of milk). In the United States over the last 100 years, milk production per cow has increased 6-fold resulting in a 55% to 60% reduction in enteric methane emissions intensity. Experiments have demonstrated that robust cows bred for grazing systems possess the capability to increase milk production by 27% to 33% when fed a total mixed ration. This opportunity of achieving a step change in production, in tandem with continuous improvements in genetic merit for milk production, could lead to substantial reductions in the intensity of environmental emissions. However, improving milk production through increased purchased feeds typically results in unintended consequences, such as reduced family-farm income and increased intensity of environmental emissions in parts of the world with favorable characteristics for pasture-based systems. Therefore, other nutritional strategies must be examined, for example, improving pasture management, developing binary or multi-species pastures, selecting superior plant genetics, and optimizing concentrate supplementation. While improvements in performance have been achieved with such strategies, further research is required to understand the nutritional limitations of pastures across the grazing season and how pasture-based diets can be efficiently modified to overcome such limitations."
Breeding and Genetics Symposium: Genomic Strategies for Alternative Dairy Production Systems Symposium Breeding and Genetics 2024/06/19 13:30:00 s10746                
Breeding and Genetics Symposium: Genomic Strategies for Alternative Dairy Production Systems Symposium Breeding and Genetics 2024/06/19 13:30:00 t91057 Watch 1595 Defining breeding goals for improved sustainability in organic production systems. 1 I. W. Haagen organic,genetics,sustainability I. W. Haagen1, L. C. Hardie2, B. J. Heins1, C. D. Dechow2 "The objective is to describe breeding goals for organic production systems that achieve profitable, healthy, and sustainable cattle. Organic dairy operations account for approximately 3% of dairy cows in the United States. The organic market demands that products come from healthy animals and are produced sustainably, all while maintaining herd profit. However, in the United States, genetic evaluations are largely based upon conventional production systems from herds participating in Dairy Herd Improvement testing, and organic dairy producers are less likely to participate in milk recording than conventional producers. Currently there are approximately 50 genetic traits evaluated in the United States. Research suggests that current US national selection indexes, such as Net Merit, will produce positive changes related to production, health, efficiency, and sustainability in organic production systems. Further, several selection indexes have been developed for alternative production systems, such as Grazing Merit, which places greater emphasis on fertility traits. However, while genetic correlation estimates between conventional and organic production systems are generally favorable, many estimates are less than unity suggesting there is reranking of sires across systems. Additionally, there are considerations for organic producers that may not be fully accounted for in current national evaluation systems. For instance, our research suggests that increased selection emphasis should be put on youngstock stayability and disease resistance in organic production compared with conventional production systems. While current national selection decisions are driving improvements in dairy production efficiency and sustainability, organic dairy producers must consider if current national breeding goals fully meet the needs of their operations."
Breeding and Genetics Symposium: Genomic Strategies for Alternative Dairy Production Systems Symposium Breeding and Genetics 2024/06/19 13:30:00 t91325 Watch 1596 Implementation of genomic selection in French dairy sheep and goats and opportunities for sustainable animal breeding. 2 H. Larroque genomic selection,dairy sheep,dairy goat H. Larroque1, J.-M. Astruc2, M. Arnal2, D. Buisson2, M. Chassier2, V. Clément2, G. Lagriffoul2, I. Palhière1, R. Rupp1, M. Teissier1, A. Legarra1, C. Robert-Granié1 "In France, the implementation of genomic selection in dairy sheep and goats seemed less obvious than in dairy cattle, due to higher relative cost of genotyping, small reference populations, and high genetic diversity. Our research work using the single-step GBLUP approach has, however, yielded genomic reliability similar to those obtained in some dairy cattle breeds, as well as higher theoretical accuracies of genomic estimated breeding values (GEBV) for genotyped young male candidates. This work led selection schemes to switch to genomic selection in the late 2010s. Studies then focused on ways of increasing reliability of genomic evaluations. In sheep, the over-dispersion of GEBV for young candidates can be reduced by taking into account missing pedigrees using the metafounders method. In goats, the genomic prediction quality can be improved by weighting SNPs (WSSGBLUP) to take account of major genes or QTLs, or by using sequence data. To assess the possibilities of building an international reference population, across-countries genomic correlations were estimated. These correlations make it possible to envisage collaborative projects between France and Spain for 2 sheep breeds, and France and Italy for goats. Genomic selection opens up the possibility of selecting new traits. Small ruminant farms are often located in areas with severe environmental constraints where they suffer the consequences of climate change. In this context, breeders are concerned about resilience and efficiency traits, key elements for sustainable animal breeding. Thus, a genomic evaluation of artificial insemination success of females has been developed for goats, and a genomic evaluation of rams for their resistance to gastrointestinal parasites is now operational in 3 breeds of sheep. Finally, research work has been carried out in both species on functional longevity, feed efficiency, milk persistency, and maturity, opening up new selection prospects. Part of this work has received funding from the European Union’s Horizon 2020 research and innovation program under grant agreement No. 772787 (SMARTER)."
Breeding and Genetics Symposium: Genomic Strategies for Alternative Dairy Production Systems Symposium Breeding and Genetics 2024/06/19 13:30:00 t91466 Watch 1597 Angus genetics—Providing crossbreeding solutions for the dairy industry. 4 K. J. Retallick beef,dairy,crossbreeding K. J. Retallick1 "The utilization of sexed semen alongside robust genetic predictions tools in the dairy sector has led to a common practice of enhancing the value of dairy byproducts through crossbreeding dairy females with beef bulls. Although this practice of integrating dairy animals into the beef supply chain is not new, the emphasis on the carcass capabilities through the right genetic selection has transformed the value of these carcasses to the beef industry. Over time targets in the beef industry have shifted from a commodity-driven to a quality-driven marketplace. In 2008, 33% of the total fed cattle populations harvested graded USDA select to that number is less than 17% today. With that, the demand for premium beef from consumers has continued to grow demand for labeling programs like Certified Angus Beef. It is approximated that today Angus has greater than 60% market share in the beef-on-dairy space. In response to the trend, Angus Genetics Inc. (AGI) worked to create profitability indexes tailored for this specific sector, including Angus-On-Holstein and Angus-On-Jersey dollar values. These indexes include fitting traits not traditionally included in our terminal beef indexes, including calving ease and modeling growth all the way from birth to harvest date. In addition, traits addressing muscling and height requirements have been added to decrease the prevalence of known issues with these carcasses. While terminal indexes designed for both these segments have a strong correlation of approximately 0.75, it is known that not all Angus bulls are suitable for this purpose. In addition, the dairy industry has the luxury of focusing on a strictly terminal mating, if those females are getting bred and calving without assistance. This allows for rapid genetic progress to take place with this supply as well as a unique opportunity for beef industry groups to collaborate on data capture refining genetic tools to support the growth in this industry. Nonetheless, with the right tools in hand, this supply can be both a profitable opportunity for the dairy producer and an asset for the beef industry."
Breeding and Genetics Symposium: Genomic Strategies for Alternative Dairy Production Systems Symposium Breeding and Genetics 2024/06/19 13:30:00 t91048 Watch 1598 Crossbreeding dairy cattle for improved production and profitability. 5 B. J. Heins crossbreeding,organic,Holstein B. J. Heins1,2, L. B. Hansen1 "Interest in crossbreeding of dairy cattle continues to increase globally. The Holstein breed has been tremendously successful in selection for milk production over the past 50 years. However, the Holstein breed was also selected for larger body size and more angularity of cows on top of the selection for production. Therefore, the Holstein breed experienced a rapid decline in these functional traits. The average inbreeding coefficient of US Holstein females born in 2023 surpassed 10%, and the annual rate of increase in average inbreeding has approached +0.4%. Heterosis from crossbreeding is the most influential for traits related to fertility, health, and survival, and it comes on top of genetic improvement within breeds. The support for breeds with robust genetic improvement programs is critical for successful crossbreeding programs. Dairy producers should select 3 breeds of dairy cattle that are appropriate for their specific management systems and use the highest-ranking AI bulls from each of the 3 breeds. A 10-year study compared cows from a 3-breed rotational crossbreeding program using the Holstein, Viking Red, and Montbeliarde breeds with their pure Holstein herdmates. Health treatment cost was 23% lower for the 2-breed crossbreds and 17% lower for 3-breed crossbreds than their Holstein herdmates. Lifetime death loss was 4% lower for both the 2-breed crossbreds and the 3-breed crossbreds than their Holstein herdmates. Daily profit was 13% higher for the 2-breed crossbreds and 9% higher for the 3-breed crossbreds than their Holstein herdmates. An ongoing crossbreeding research study at the University of Minnesota West Central Research and Outreach Center, Morris, Minnesota, dairy will evaluate the production, health, and most importantly, the economic performance of crossbred dairy cattle compared with their Holstein herdmates. Future studies will evaluate methane emissions, fatty acid composition of milk, parasite resistance, as well as economic impacts of crossbreeding. The results will help improve the long-term profitability and social sustainability of the dairy industry by improving its public image."
Dairy Foods Milk Protein & Enzymes Committee Symposium: Casein Structure and Chemistry Symposium Dairy Foods 2024/06/18 13:30:00 s10697                
Dairy Foods Milk Protein & Enzymes Committee Symposium: Casein Structure and Chemistry Symposium Dairy Foods - MPE Symposium 2024/06/18 13:30:00 t91991 Watch 1380 Casein micelles structure and processing functionality. 1 M. Corredig casein micelle,processing,structure M. Corredig1 "Casein micelles are one of the most studied food colloids due to their major role in the stability and processing functionality of milk and milk ingredients. As novel ingredients become avaialable, obtained either by recombination of single caseins or by membrane filtration, our understanding of their structure and functionality relationship is put into question. Changes in environmental conditions, and ratios between the different components may modify the internal structure while maintaining similar size and shape, or modify their colloidal to soluble equilibrium. Furthermore, membrane concentration processes can cause in situ modifications of their colloidal properties, with consequences to their functionality, with new opportunities for innovation and the generation of new value-added ingredients. There is then a greater than ever need for understanding the details of the structure of casein micelles, to ensure their quality and consistency of functionality. This paper summarizes our current knowledge of the important factors affecting the colloidal structure of the casein micelles as well as the modifications leading to differences in their structuring properties."
Dairy Foods Milk Protein & Enzymes Committee Symposium: Casein Structure and Chemistry Symposium Dairy Foods - MPE Symposium 2024/06/18 13:30:00 t92209 Watch 1381 Caseins: The structure-function relationship in cheese. 2 J. J. Sheehan   J. J. Sheehan1 "Caseins, their aggregation, properties, and interactions with other components are key to determining cheese structure function properties. During rennet coagulation, destabilized casein micelles aggregate into chains and clusters, leading to formation of a 3-dimensional gel concentration of casein. Other constituents (e.g. fat globules, water, minerals, bacteria, and dissolved solutes) are all interspersed within this casein matrix. Calcium bonding, electrostatic interactions, and hydrogen bonds (to a lesser degree) between caseins contribute to the formation and stability of the para-casein matrix (after the pressing stage) while interactions such as the localized balance of the attractive and repulsive forces between casein influence the functionality of cheese including the melting properties of heated cheese. Similarly, modulation of the levels of colloidal calcium associated with the casein present in the cheese matrix alters the texture and cooking properties of cheese, with decreased levels contributing to softening of the cheese texture (particularly early in ripening) while higher levels confer an elastic texture, important for sliceability in avoiding crumbliness or adhesion to cutting equipment. Cheese stretch properties have been linked to hydrophobic peptides, as products of casein hydrolysis, present in the pH 4.6-soluble nitrogen regardless of casein origin (i.e., whether derived from αS1-CN, αS2-CN, or β-CN) and are thought to interact with the protein matrix or with other large peptides via hydrophobic forces, possibly forming fibers in the cheese matrix. Cheese texture, rheological, and cooking properties are influenced by both varying pH and temperature. The former through alteration of casein-casein, mineral casein, and casein-water interactions while elevated temperature during heating of cheese is proposed to lead to reduction in the contact area between casein, leading to weakening of the cheese matrix and decreases in G′ and G″ and an increase of loss tangent. Overall leverage of casein chemistry and interactions with other cheese matrix constituents are key to controlling cheese structure-function properties."
Dairy Foods Milk Protein & Enzymes Committee Symposium: Casein Structure and Chemistry Symposium Dairy Foods - MPE Symposium 2024/06/18 13:30:00 t91270 Watch 1382 Animal-free caseins: Challenges in recreating casein micelles and related functional properties. 3 J. A. Lucey precision fermentation,recombinant technology,animal-free J. A. Lucey1,2 "Recently, various startups have stated that their goal is to create animal-free caseins that have identical functionality to those produced by the cow. Recombinant protein technology has been used to produce various enzymes like rennet. In this approach, genetically modified microorganisms like yeast/bacteria are engineered to express the gene for the target protein (e.g., a casein). This modified microorganism is then fermented to grow and produce the target protein, before isolation and concentration steps are applied. More recently, this approach has been described as precision fermentation. Other approaches include transgenic plants that can express the target casein, and lab-grown milk using cell culture lines of mammary cells. Caseins undergo significant post-translational modifications of the primary sequence, including phosphorylation (at primarily serine amino acids, which directly determines the extent of calcium binding) and glycosylation at a single site on kappa-casein. The bioassembly of casein micelles occurs in the Golgi apparatus of the mammary cell, under tightly controlled ionic conditions that promote the formation of insoluble calcium phosphate nanoclusters, which acts as a crosslinking material between casein molecules. Association of hydrophobic segments also promotes casein association and elongation. Incorporation of kappa-casein into the aggregating casein chains terminates the growth of the micelle since it cannot form further calcium phosphate crosslinks. At least 4 different types of caseins are involved in the structure of casein micelles produced by the cow. Artificial casein micelles were created in the 1970s by careful manipulation of the ionic environment, but the caseins used had already undergone post-translational modifications. Without a mammary cell, its unclear if the necessary and identical post-translational modifications will occur, and where the critical bioassembly process will occur, which is required for micelle formation. There have not been any published studies on the post-translational modifications or functionality of any animal-free caseins."
Dairy Foods Milk Protein & Enzymes Committee Symposium: Casein Structure and Chemistry Symposium Dairy Foods - MPE Symposium 2024/06/18 13:30:00 t91992 Watch 1383 Tearing down casein micelles: An alternative clean-label ingredient approach. 4 F. Harte casein,processing,clean-label F. Harte1 "The casein micelles in bovine milk serve as the building blocks of a range of dairy foods, including yogurt and cheese. Despite outstanding progress in our capacity to extract functionality from casein, we still face roadblocks when it comes to leveraging the structure-function properties of the casein proteins and the casein micelles. Over recent years, members of the Harte laboratory have delved into exploring the physicochemical stimuli leading to the breakdown of native casein micelles, into monomeric casein proteins and smaller casein aggregates. This presentation will focus on 3 avenues conducive to the dissociation of the casein micelles: high-pressure technologies (e.g., hydrostatic, homogenization, jets), the modification of the ionic environment (e.g., by adding citrates, phosphates, tartrates), and co-solvation (e.g., by exposure to ethanol). The transformative effects on casein functionality resulting from “tearing down the casein micelles” will be stressed, highlighting improvements in emulsifying properties, protein-polysaccharide stabilization, and the formation of casein-based nano-scale fibers, amorphous solid dispersions, and films. Throughout the presentation, attention will be drawn to 2 crucial aspects: (1) the current limitations in analytical tools that prevent us from better understanding structural features of the casein micelle, and (2) the significant potential for functionalizing casein toward clean-label applications in food and nonfood materials."
Dairy Foods Milk Protein & Enzymes Committee Symposium: Casein Structure and Chemistry Symposium Dairy Foods 2024/06/18 13:30:00 n9107 Watch   Discussion 5        
Dairy Foods Symposium: A Systems-Based Approach to Drive Innovation in Dairying Symposium Dairy Foods 2024/06/18 13:30:00 s10686                
Dairy Foods Symposium: A Systems-Based Approach to Drive Innovation in Dairying Symposium Dairy Foods 2024/06/18 13:30:00 t91516 Watch 1384 An introduction to Dairy Management Inc.’s research priorities. 2 K. Alexander Dairy Management Inc. (DMI),research,innovation K. Alexander1, S. Masiello Schuette1, M. Pikosky1, C. Galer1 "Dairy Management Inc. (DMI) is focused on elevating US dairy through innovation, sustainability, and enhancing its public image, aiming to foster trust, drive sales, and ensure industry sustainability. The Strategic Intelligence team propels this vision with insights and analytics in areas like Foresight, Discovery and Trends, and Innovation and Growth, making informed decisions to navigate future challenges. The Environmental Research program champions sustainability, researching practices to reduce emissions and improve water efficiency, contributing to a greener dairy industry. Simultaneously, the Nutrition Research program explores dairy’s health benefits, promoting its nutritional value and boosting consumer demand. The Dairy Products Research team furthers DMI’s mission by innovating and expanding dairy choices through targeted R&D, addressing consumer preferences, and opening new market avenues. This coordinated effort across DMI’s departments underscores a holistic strategy to not only rejuvenate US dairy’s image but also solidify its market leadership and commitment to wellness and environmental responsibility. The objective of this talk is to illustrate how these diverse departments collaborate to achieve DMI’s overarching goals, showcasing a unified front in redefining the future of the US dairy industry."
Dairy Foods Symposium: A Systems-Based Approach to Drive Innovation in Dairying Symposium Dairy Foods 2024/06/18 13:30:00 t90852 Watch 1385 Unlocking innovation opportunities for dairy in health and wellness. 3 K. Alexander innovation,trend,insight K. Alexander1 "A growing number of US consumers are actively managing their health. In fact, health and wellness is the number 1 area of disposable income spending. As consumers look to functional foods and beverages for a variety of health and wellness reasons, dairy is in a prime position to be their solution. This session will dive deep into research that explores (1) who the health and wellness consumers are, (2) the top conditions they are looking to treat and prevent, (3) global health and wellness trends, and (4) dairy’s opportunity to innovate within this space."
Dairy Foods Symposium: A Systems-Based Approach to Drive Innovation in Dairying Symposium Dairy Foods 2024/06/18 13:30:00 t92078 Watch 1389 Existing and emerging microbial challenges in the dairy industry. 4 N. Martin microbial,spoilage,safety N. Martin1 "The microbial quality and safety of dairy products are drivers of consumer acceptance and trust in the dairy industry and are critical to ensuring continued domestic and international demand. Addressing microbial contamination is critical throughout the grass-to-glass continuum, and requires a comprehensive approach that integrates monitoring dairy products for emergent microbial spoilage and safety risks, tracking and typing microbes for source detection, the development of digital tools to facilitate incremental improvements and aid in decision-making, and supporting the industry with guidance and training. In the Milk Quality Improvement Program at Cornell, our research is aimed at bridging the gap between practical strategies and innovative approaches to facilitate microbial quality and safety improvements in the dairy industry."
Dairy Foods Symposium: A Systems-Based Approach to Drive Innovation in Dairying Symposium Dairy Foods 2024/06/18 13:30:00 t91017 Watch 1386 Innovative integrations: Genomics, milk spectrometry, and microbial manipulations to mitigate enteric methane emissions from dairy cattle. 6 F. Peñagaricano greenhouse gas,selective breeding,sustainability F. Peñagaricano1 "The overall goal of this multi-institutional, multi-disciplinary project is to mitigate enteric methane emissions from dairy cattle by combining selective breeding, milk mid-infrared spectra data, and rumen microbiome interventions. We will measure methane emissions, feed intake, energy-corrected milk, body weight, and milk mid-infrared spectra for 6 to 8 weeks in roughly 4,000 mid-lactation Holstein cows. To enable selective breeding for methane emissions, we will develop genomic evaluations for methane traits, including methane production, residual methane yield, and residual methane intensity, and incorporate these traits into US dairy cattle selection indices. To develop effective milk spectra-based solutions, we will determine the value of using milk mid-infrared spectra as a noninvasive approach to predict enteric methane emissions. To decipher how the rumen microbiome affects methane production, we will identify low and high methane-emitting individuals among the 4,000 reference cows and investigate the composition and activity of the rumen and oral microbiome using omics technologies. We will also exchange ruminal contents in a subset of low- and high-methane-emitting cows to decipher the relative contributions of hosts and microbes to methane production. Overall, we will deliver multiple solutions to mitigate methane emissions from dairy cattle, which will safeguard the economic, environmental, and social sustainability of the US dairy industry."
Dairy Foods Symposium: A Systems-Based Approach to Drive Innovation in Dairying Symposium Dairy Foods 2024/06/18 13:30:00 t91786 Watch 1387 Anabolic potential of dairy and dairy proteins in active youth. 7 D. Moore exercise,youth,growth D. Moore1 "Physical activity during childhood and adolescence is vital for the growth and development of lean tissues including muscle and bone. The net acquisition of lean tissue, which is constantly “turning over” through the breakdown of old/damaged proteins and the synthesis of new proteins in their place, must be underpinned by a positive net protein balance (NB = synthesis − breakdown). Provided energy needs are met, dietary protein provides the requisite amino acid building blocks to build body protein during growth. Dairy and dairy proteins have been shown to enhance skeletal muscle anabolism (i.e., growth) in adults after exercise primarily through the ability to support elevated rates of muscle protein synthesis. The anabolic potential of dairy and dairy proteins in adults may be related to the protein density of milk, the high essential amino acid content of dairy protein, and/or food matrix effects. This presentation will summarize the emerging research to date on the ability of dairy and dairy proteins to support a positive whole-body NB after physical activity in children and adolescents. Topics to be discussed include the quantity of dairy protein, its quality relative to plant-based proteins, and the anabolic potential of dairy vs. dairy-alternative beverages. Using whole-body stable-isotope methodology, our recent research has demonstrated that milk protein is able to induce a positive whole-body NB in children after exercise in a dose-dependent manner. As little as 5 g (~0.15 g protein/kg body mass) of MPC is able to induce a positive NB after exercise in children(2). Further, we have demonstrated that body protein balance is maximized and dietary amino acid oxidation (use as energy) is minimized at a MPC intake of ~0.3 g protein/kg(1, 2), which approximates ~1.5 servings of 250 mL of fluid milk for a 35-kg child. Thus, dairy protein represents an excellent source of dietary amino acids that would support efficient acute ‘growth’ after activity in children and adolescents. (1) Moore et al., J. Appl. Physiol. 117:1493, 2015. (2) Volterman et al., J. Nutr. 147:807, 2017."
Dairy Foods Symposium: A Systems-Based Approach to Drive Innovation in Dairying Symposium Dairy Foods 2024/06/18 13:30:00 t92022 Watch 1388 Innovative pathways in scaling benchtop discoveries to health and wellness ingredients. 8 S. Ropiak innovation,commercialization,encapsulation S. Ropiak1, T. Lin2, L. Yang2, Y. Dadmohammadi2, H. Meletharayil1, R. Kapoor1, E. Nashed1, A. Abbaspourrad2 "Dairy Management Inc. (DMI) and its related organizations work to increase sales and demand for dairy through research, education, and innovation, and to maintain confidence in dairy foods, farms, and businesses. The DMI Dairy Products Research group strives to advance DMI’s priorities through targeted research and development activities that address consumer needs and expand dairy choices in domestic and international markets. This includes funding research projects at various dairy research centers and universities in the United States. These programs lead to cutting-edge research findings, platform technologies, and quality and food safety solutions that enable the US dairy industry to generate high-quality, innovative products and ingredients. The objective of this talk is to demonstrate the powerful potential of collaboration, innovation, and consumer insights on shaping the future of the US dairy industry with a lens of health and wellness by showcasing a current project led by DMI Dairy Products Research group that has successfully progressed from conception to commercialization. One of the key focus areas for DMI is the development of novel dairy products and ingredients for health and wellness. In partnership with DMI’s Strategic Intelligence team, a landscape study was completed to identify 2 dairy-forward bioactives, lactoferrin and tryptophan, to deliver toward consumer health and wellness needs related to immunity and calming, respectively. However, both ingredients face product development challenges when incorporated in foods and beverages, such as heat instability (lactoferrin) and off-flavors (tryptophan). Through a partnership with DMI and Cornell University, a novel encapsulation process was developed to protect these ingredients and have successfully scaled up these novel ingredients for their successful use in dairy and food products. This research model aims to serve as a template for future dairy innovation commercialization research."
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 s10614                
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 n9103 Watch 9000 Who is Dr. Susan Duncan? 1 Nicole Martin      
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 t91273 Watch 1000 Engaging today’s undergraduate women with the field of dairy science. 2 G. Lewis dairy foods,undergraduate,research G. Lewis1 "Dr. Susan Duncan had an incredible ability to guide students, both undergraduate and graduate level, through a warm, supportive mentoring style. Dr. Duncan’s approach is fundamental to retaining students and guiding them toward careers in dairy foods-related fields, especially for undergraduate student populations. With this, this presentation intends to highlight some approaches I have taken to mentor undergraduate students in my early career as an Assistant Professor. The accomplishments of undergraduate students at the University of Wisconsin–River Falls will be highlighted, including research conducted on whey protein films, lactose-free ice cream, and dairy product development. The goal of this session is to recognize the extraordinary capacity of undergraduate researchers when encouraged and supported through mentoring styles motivated by Dr. Susan Duncan’s legacy."
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 t90878 Watch 1001 Mentoring while still being mentored: Championing women in dairy science as an early career faculty. 3 S. Mann peer mentoring,women,dairy science S. Mann1 "Effective mentorship can have a profound impact on professionals at every step of their career. Even though the field has seen a shift to have more than half of the graduates in agriculture bachelor degrees be women, female professionals and those belonging to minority groups are traditionally underrepresented among dairy scientists, particularly in leadership positions. Early career mentorship provides the opportunity to help navigate challenges typical to this stage of a scientist’s career and provide ways to retain and promote a diverse workforce during this critical phase. As opposed to mentorship provided by senior professionals in a typical one-way relationship of providing advice and solutions to the less experienced mentee, peer mentorship can be an effective strategy to enrich both the mentor and mentee’s development and create camaraderie among like-minded individuals learning and progressing together. The roles of mentor and mentee can be interchangeable in these relationships. This presentation as part of the Championing Women in Dairy Science: Remembering the Legacy of Sue Duncan symposium will focus on the unique aspects of being a mentor while still being mentored as an early career faculty member."
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 t91617 Watch 1002 Navigating industry careers as a woman in dairy science. 4 L. L. Colby dairy science,women,industry L. L. Colby1 "Working in industry presents unique challenges and opportunities for women pursuing a career in dairy science. This is demonstrated through recent data on industry gender disparities. While we have made significant progress over recent decades, there are additional approaches we can take, which will be described. One area of emphasis we can continue to improve is technical leadership development within industry technical career tracks, in addition to people leadership development programs and training."
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 t90896 Watch 1003 Being a mom and doing research about moms: When life and work collide. 5 L. L. Hernandez lactation,mom,mammals L. L. Hernandez1 "I knew I always loved mammals; however, it was not until graduate school that I was introduced to a project focused on understanding how a mother, specifically a dairy cow, could control the composition and amount of milk being made while maintaining her own physiology. I was hooked, the birth of a lactation physiologist. It was the first time I truly understood the word homeorhesis. I went on to study how molecules in the mammary gland influenced maternal physiology in the mouse and the human as a postdoctoral fellow. I was 7 mo pregnant when I started my faculty position, and 2 mo later my daughter was born, and a passion was cemented upon becoming a mother that has informed every research question I have had and every mentoring approach I have taken. No one prepared me for that experience: for being discharged from the hospital and being told we would see the baby for a bunch of appointments, but not you for 6 weeks; for what it would be like lecturing in lactation physiology and desperately needing to pump; or for how being up all night feeding or consoling a child would send my stress level through the roof. Experiences I have had as a mom have made me determined to focus my work on improving maternal health during the peripartal period, whether that is in a cow, mouse, or human, as well as making me a better mentor due to the expansion of my empathy for humans that is not to be explained until you become a parent. This path has led me to a location where it is impossible for me to separate my work and passion for improving maternal health, where every research question and experiment somehow impacts my actual life as a mom. Today I continue to focus my research on various aspects of improving the physiology of mothers, whether that be a dairy cow, mouse, or a human. I would like to think that the collision of a lactation physiologist with motherhood has made my research that much better, and that being a mom has made me a better scientist and mentor. Without those women in animal science before me, though, these things would not have seemed possible to the young woman who showed up in a lab and had a love for mammals."
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 t91041 Watch 1004 Building a strong team. 6 M. A. Drake leadership,team building,graduate students M. A. Drake1 "Team leadership requires vision, passion, commitment, and communication. An engaging environment with clear expectations is a pathway for success. The role of team leadership on graduate education will be discussed."
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 t91541 Watch 1005 The critical role of leadership positions in the dairy industry. 7 K. Plaut Susan Duncan,leadership,dairy K. Plaut1 "In any industry, it is important to hear the perspectives of a wide variety of people. There are many distinct types of leadership roles in the dairy industry, from farmer to academician to industry or co-op leader, but they all have some common attributes. I will highlight some of the leadership values Dr. Susan Duncan brought to the table as a leader at Virginia Tech and in the dairy industry. Dr. Duncan brought a spirit of service to the dairy industry coupled with innovation—finding new ways to improve research facilities and processes for the future. She had passion for science and for leadership because she cared about her university and the industry. Dr. Duncan had a communication style that created an inclusive environment and made everyone in the room feel valued. We will discuss these leadership values and more as we discuss the critical role for leadership in the dairy industry."
Dairy Foods Symposium: Championing Women in Dairy Science: Remembering the Legacy of Susan Duncan Symposium Dairy Foods 2024/06/16 14:00:00 n9104 Watch   Panel Discussion 8        
Dairy Foods Symposium: Next Generation of Scientific Leaders in the Field of Dairy Foods Science Symposium Dairy Foods 2024/06/18 09:15:00 s10690                
Dairy Foods Symposium: Next Generation of Scientific Leaders in the Field of Dairy Foods Science Symposium Dairy Foods 2024/06/18 09:15:00 t90894 Watch 1316 Harnessing research to boost innovation and develop future leaders: Fueled by dairy farmers. 2 R. Kapoor dairy farmers,research,future leaders R. Kapoor1 "The objective of this talk is to emphasize the importance of US dairy farmer-funded initiatives that fuel new product innovation and enable the development next generation of dairy leaders, consequently helping grow the US and global dairy industry. Dairy Management Inc. (DMI) was created in 1995 to help increase demand for US-produced dairy products on behalf of America’s dairy farmers. DMI and its related organizations work to increase sales and demand for dairy through research, education, and innovation, and to maintain confidence in dairy foods, farms, and businesses. One of the key departments at DMI to help fulfill the above goals is the Dairy Products Research group. The DMI Dairy Products Research group strives to advance DMI’s priorities through targeted research and development activities that address consumer needs and expand dairy choices in domestic and international markets. This includes funding research projects at various dairy research centers and universities in the United States. These programs lead to cutting-edge research findings, platform technologies, and quality and food safety solutions that enable the US dairy industry to generate high-quality, innovative products and ingredients. Furthermore, the group directs strategic resources to offer expert product and process development, technical support, and food safety and quality resources to the US dairy industry. Developing the current and future workforce through education and development through the National Dairy Foods Research Centers is also one of our primary goals."
Dairy Foods Symposium: Next Generation of Scientific Leaders in the Field of Dairy Foods Science Symposium Dairy Foods 2024/06/18 09:15:00 t91980 Watch 1317 Milk protein functionality: Colloidal and interfacial aspects. 3 H. Zheng milk protein,whey protein,colloid and interface H. Zheng1 "In general, fresh milk may be considered as a colloidal system containing dispersed fat globules and protein particles. Bovine milk, depending on the source dairy cattle breeds, may contain about 30 to 36 g/L of protein. There are 6 major types of milk protein. Four of them are αS1-casein, αS2-casein, β-casein, and κ-casein, assembled with calcium phosphate to form casein micelles; 2 of them are β-lactoglobulin and α-lactalbumin, presented in soluble form and known as whey proteins. Structure determines functionality. Milk proteins have been concentrated, fractionated, and even modified to make protein-based ingredients for constructing different mesoscopic and microscopic structures, including aggregates, gels, emulsions, and foams for improving texture and phase stability of many food products. The scope of this presentation focuses on (1) introduction of fundamentals of colloid and interface science and (2) investigation of how this knowledge guides research regarding modifying and charactering milk protein functionality using recently obtained results as examples. The presentation will discuss (a) approaches to assembling whey proteins into colloid particles as gelling agents and oil-water interface stabilizers; (b) significance of large deformation rheological properties on characterizing whey protein gel texture; (c) indicating phase stability of UHT reconstituted skim milk using information obtained from spectroscopy techniques and physicochemical properties."
Dairy Foods Symposium: Next Generation of Scientific Leaders in the Field of Dairy Foods Science Symposium Dairy Foods 2024/06/18 09:15:00 t91226 Watch 1318 Dairy components in pharmaceutical and value-added applications. 4 G. Lewis milkfat,parenteral nutrition,casein G. Lewis1 "The importance of adding value to dairy products has been an attractive research topic in recent years. The goal of the present work is to highlight 2 current research projects targeting value-added products, with applications in both the food and the pharmaceutical industries. First, a project looking to target milkfat as an intravenous lipid source for parenteral nutrition (PN). PN is a lifesaving strategy for patients (>300,000 patients per year in the United States) who cannot feed via the gastrointestinal tract due to trauma, surgery, premature birth, or other intestinal complications. Common PN lipid sources (e.g., olive oil, soybean oil, fish oil) cause a variety of complications, mostly due to their limited complexity. In this application, milkfat, with a more diverse fatty acid profile than typical PN lipids, must achieve emulsion particle sizes of 200–500 nm, and this was accomplished through high-pressure homogenization. Initial studies applying these emulsions in stimulated macrophage and mouse models have shown promising results, including reduced inflammatory response, anti-inflammatory response, reduced respiratory exchange ratio, and reduced pancreatic cell inflammation compared with soy-based intravenous lipid emulsions. Second, a project targeting optimized casein micelle dissociation for dairy product functionalization and nanoparticle applications. In this application, casein micelle dissociation was maximized through emulsifying salt addition and high-pressure homogenization, revealing more hydrophobic residues for target compound interactions. Together, these projects highlight novel, ongoing research with considerable economic potential for the dairy industry."
Dairy Foods Symposium: Next Generation of Scientific Leaders in the Field of Dairy Foods Science Symposium Dairy Foods 2024/06/18 09:15:00 t91801 Watch 1319 Tailoring dairy-based ingredient functionality. 5 P. Salunke dairy-based ingredient,functionality,tailoring P. Salunke1 "Milk is a heterogeneous mixture of soluble, colloidal, and suspended particles. Due to this heterogeneity, it is possible to separate or fractionate particles and develop new ingredients with altered fat-to-protein, casein-to-total protein, or protein-to-total solids ratios in the finished product compared with regular milk, which has an impact on microstructure and functionality. The functional and economic value of the ingredient becomes higher than the milk itself. Manufacturing dairy-based ingredients involves separation or fractionation, concentration, and drying. The developmental approaches for manufacturing milk can be broadly categorized into fat-only, lactose-only, and high-protein ingredients (normal ratio of milk constituents, whey or serum protein-rich, and casein-rich). These ingredients can be used as is, in concentrated or dried form. The fat- and protein-rich ingredients are used for flavor, structure, and texture development, and the molecular structure and surface properties play a significant role in functionality. These dairy-based ingredients can be used in various products, providing critical functional properties, including texture, water binding, viscosity, gelation, emulsifying, and foaming. However, some ingredients alone cannot deliver critical functional properties required in certain products, such as high heat-stable products, emulsions, cheese, and yogurt. Hence, modification of these ingredients is necessary for providing targeted and tailored functionality. In understanding factors that affect the functional properties, many technological, engineering, research, and development efforts have led to the production of dairy ingredients tailored for specific applications. Common approaches followed are processing modification, physical (e.g., membrane processing, heat) and chemical (e.g., pH, additives) modification, and biological (e.g., starter culture) or enzymatic (hydrolysis or crosslinking) modification, or a combination of 2 or more approaches. Various approaches for tailoring dairy-based ingredient functionality are available, but the selected approach should be controllable, efficient, safe, cost-effective, and eco-friendly."
Dairy Foods Symposium: Next Generation of Scientific Leaders in the Field of Dairy Foods Science Symposium Dairy Foods 2024/06/18 09:15:00 t91277 Watch 1320 Generating added-value dairy products: A West Coast perspective. 7 C. Licon innovation,added-value,dairy products C. Licon1 "In the dynamic landscape of California industries, innovation remains a pivotal part, and the dairy industry stands as a prime example, continually evolving to meet emerging trends and consumer preferences by adding value to its products. The purpose of this presentation is to outline my professional goals to establish robust infrastructure and educational capabilities within California higher education institutions, focusing on fostering innovation in dairy foods through extensive multidisciplinary research. With a commitment to promoting culturally diverse and artisanal dairy production, coupled with a fervent dedication to advancing innovation in dairy processing, my research endeavors are aimed at assisting industry businesses. This commitment extends to enhancing the overall quality of dairy products through various avenues: (1) the incorporation of regional products to increase value; (2) the identification of natural solutions to mitigate late blowing in cheese; (3) an exploration of the perceptions of cheese aromas; and (4) the upcycling of whey for beer production and algae cultivation. Recognizing the transformative potential of machine learning in recent years, I have observed a new perspective that can revolutionize the dairy industry and open avenues for applications that can significantly enhance innovation. A systematic review reveals that machine learning is successfully employed across diverse domains, covering composition analysis, quality control, optimization, authentication, processes, sensory evaluation, manufacturing, and detection of adulteration. Aligned with this paradigm shift, machine learning presents unprecedented opportunities to forge synergies and collaborations to support dairy producers in previously unexplored ways. The results of this research indicate that machine learning has the potential to not only transform but also deepen the impact on the dairy industry, creating a profound and lasting influence on dairy food innovation. In conclusion, innovation in dairy products is my approach to promoting collaboration and engagement, and to expand the offer of culturally diverse dairy products and educational opportunities."
Dairy Foods Symposium: Next Generation of Scientific Leaders in the Field of Dairy Foods Science Symposium Dairy Foods 2024/06/18 09:15:00 t91115 Watch 1321 Understanding the structure-function relationship in dairy food matrices using material science approaches. 8 P. Sharma structure-function relationship,dairy foods,rheology P. Sharma1 "Dairy foods are available in variety of forms, including liquid, semi-solids, solids, and powders. The desired functionality of these foods depends upon end user application. Any specific functionality in a food matrix is derived from the multiple layers of food structure, the way different molecules interact with each other at different length scales and form a basis for bulk material properties. Modifying food structure through changing formulation or processing conditions is an effective way of controlling functionality. This presentation will cover the dairy research being conducted at Utah State University by Assistant Professor Prateek Sharma in the area of functionality of dairy powders, cheese, and gels. His talk will focus more on how the use of novel material science approaches may not only be helpful in understanding structure-function relationship in various dairy food matrices but also could potentially improve profitability and sustainability of commercial dairy manufacturing operations."
Dairy Foods Symposium: Next Generation of Scientific Leaders in the Field of Dairy Foods Science Symposium Dairy Foods 2024/06/18 09:15:00 t91932 Watch 1322 Sustainable process and healthy dairy product solutions. 9 M. S. Mohan nanobubbles,protein,environment M. S. Mohan1 "The global dairy industry is one of the fastest-growing food industries, worth 893 billion US dollars in 2022, eliciting the most conversations of health and environmental impacts of dairy processing. Dairy products and ingredients are highly nutritious with versatile compositions, properties, functionality, and applications. The US fluid milk carbon footprint involves about 28% contribution of the dairy processing sector and the consumer supply chain. This footprint is associated with the high load of total solid waste and byproduct streams from dairy processing, elucidating the need for measures to evaluate the sustainability and efficiency of individual products lines. The US dairy Net Zero initiative 2050 plans to advance research and technology focusing on mitigating the large farm-to-fork carbon footprint of the dairy industries. There is awareness in the market and among consumers about the importance of sustainability and health impacts of dairy processing. Some novel trends have been identified that could impact the performance and future direction of the dairy industry, including novel processes and technologies, consumption and market patterns, and health and environmental impacts of dairy processing and products. We have investigated novel processing technologies, including nanobubble and ultrasound technology, that showcase huge potential as clean and sustainable technologies, as they do not require the use of processing aids and chemical additives. In addition, the diverse physicochemical and nutritional attributes of dairy products and ingredients can be utilized for the delivery of bioactive compounds and catering to consumers’ healthy-eating demands such as high protein content. Themes that have emerged with the environmentally conscious consumer market include the importance of upcycling, reduction of waste, and sustainability in dairy processing. Overall, there is need for research in the areas of novel processes and scale-up, measurement of sustainability, innovative clean label products and ingredients, utilization of waste and byproduct streams, and overall effective use of consumer trend evaluations and artificial intelligence in the dairy industry."
Dairy Foods Symposium: Novel Technologies to Improve the Texture and Flavor of Cheese Symposium Dairy Foods 2024/06/17 09:15:00 s10623                
Dairy Foods Symposium: Novel Technologies to Improve the Texture and Flavor of Cheese Symposium Dairy Foods - Novel Technologies to Improve the Texture and Flavor of Cheese 2024/06/17 09:15:00 t92005 Watch 1143 Use of membrane concentrates in cheesemaking. 2 S. Govindasamy-Lucey ultrafiltration,microfiltration,cheese S. Govindasamy-Lucey1 "Historically there has been lot of interest in using highly concentrated milks for cheesemaking, which would avoid any whey drainage (thus improving yield due to whey protein retention). Those efforts have been largely unsuccessful. Reverse osmosis of milk has been used to concentrate cheese milk but suffers from increasing lactose levels, which raises the risk of excess cheese acidity. Ultrafiltration (UF) has been the membrane concentration approach most widely applied to cheese manufacture, where 3 different forms of UF, categorized on the basis of concentration factor (CF) or degree of milk protein concentration, are used. The most common approach is low-CF UF and is used mainly for milk protein standardization followed by cheesemaking and whey removal using conventional equipment. This has been successfully used in many parts of the world for various cheeses as long as the casein (CN) content is <4%; then only minor modifications are required. Higher levels of CN require more substantial changes, especially in coagulation and cutting phases. Use of highly concentrated UF can result in elevated whey protein in cheese, which can negatively impact ripening. Low-CF microfiltration (MF) has become popular over the last 10 years. It allows the cheese milk to be standardized to a CN content while removing serum proteins as milk-derived whey (which has flavor and functional benefits over traditional cheese whey). As CN content increases, moisture of the cheese is often reduced, unless corrective steps are taken. Similarly, the cheese can be tougher unless preacidfication is employed. Using MF to deplete most whey proteins in cheese milk does not impact the nutritional profile, and more characteristic ripening is observed. The benefits of using low-CF UF or MF include more consistent coagulation, improved yield, and in some cases higher fat or CN recoveries, as well as more consistent products. While concerns remain regarding the impact of using low CF UF or MF for standardizing protein or CN content in cheese milk on cheese quality and manufacturing cost, these approaches are likely to become mainstream because of the greater demand for more consistent cheese composition and quality."
Dairy Foods Symposium: Novel Technologies to Improve the Texture and Flavor of Cheese Symposium Dairy Foods - Novel Technologies to Improve the Texture and Flavor of Cheese 2024/06/17 09:15:00 t91319 Watch 1144 Use of lactose standardization: A sustainability tool. 3 R. A. Ibáñez lactose-to-casein ratio,cheese acidity,membrane filtration R. A. Ibáñez1 "In various cheese varieties, fermentation of lactose into lactic acid is needed to target a required pH and thus obtain a desirable appearance, flavor, texture, and functionality. However, the quality of cheese is negatively impacted when excessive acid development occurs. To address this issue, water can be directly added into the cheese vat during manufacture (i.e., curd washing/rinsing, CWR; whey dilution, WD) to remove undesirable lactose from the curd and control final levels of lactic acid. This approach may require a large volume of water (up to 45% of initial cheese milk) and typically leads to cheeses with variable acid development, as this step is influenced by several factors (initial milk composition, temperature of water added, curd particle size). As an alternative, the lactose content of milk can be adjusted prior to cheese manufacture using an approach called lactose standardization (LS), which consists of applying low-concentration factor ultrafiltration (UF) in milk to increase levels of total solids to ~18%, followed by recombining the UF milk retentate with permeate and water to reduce the natural lactose-to-casein ratio (L:CN) found in milk (~1.8:1.0) and effectively control acid development and pH of cheese. The amount of water used in this technique could be lower than in CWR or WD, but its direct application into milk can affect the content and solubilization of Ca, which can modify the texture and melting properties of cheeses. The LS technique can be applied in either regular or concentrated milks (i.e., increased casein content), although modification to cheese manufacture protocols are required to achieve desirable moisture content; can be used to replace CWR/WD in Gouda and Colby cheeses; and can potentially reduce the incidence of common defects, such as calcium lactate crystals (Cheddar) and browning (Mozzarella) due to accumulation of excess lactic acid and sugars, respectively. Standardization of milk to a defined L:CN would allow cheese manufacturers to tightly control acidity and pH of cheeses. From a sustainable perspective, LS could also help reduce the use of water during cheese manufacture."
Dairy Foods Symposium: Novel Technologies to Improve the Texture and Flavor of Cheese Symposium Dairy Foods - Novel Technologies to Improve the Texture and Flavor of Cheese 2024/06/17 09:15:00 t91082 Watch 1145 Metagenomic insights into cheese ripening and spoilage. 4 G. LaPointe cheese typicity,defects,microbial ecology G. LaPointe1,2 "Metagenomics is generally defined as the study of the structure and function of all the nucleotide sequences isolated from a community of microorganisms. These sequences can be derived from live or dead microbial cells, or come directly from the sample matrix as eDNA, depending on the DNA extraction procedure applied. On their own, DNA sequences provide a view into the cumulative history of the microbial community from starter dominance in early curd formation to the later development of the non-starter lactic acid bacteria community and extending to phage as well as yeast and fungal sequences. The challenge resides in the computational methods to extract meaning from these sequences and integrate this data with the phenotypic, chemical, or sensory dimensions of cheese ripening and spoilage. Ultimately, with metagenomics, we hope to surpass the limitations of taxonomy to reveal how we can use these microbial functions and sequences to predict the progression of cheese quality. Case studies using metagenomics approaches have been published over the past decade, covering a breadth of cheese types (feta cheese, surface ripened cheeses, artisanal cheeses, washed rind cheeses, Cheddar cheeses), including a longitudinal study of Cheddar cheese over 3 years of ripening. Insights have been generated on the variations among cheese types, aging, countries, geographical regions, and processing conditions and techniques, revealing new species that could be contributing to taste and color. As an example, slit detection has been correlated with low levels of thermoduric heterofermentative Lactobacillus by sequencing propidium monoazide-treated DNA. With metagenomics, we can finally achieve near strain-level diversity analysis of specific taxa such as Lacticaseibacillus paracasei to predict their individual contributions to sensory parameters and volatile compounds produced during cheese ripening. Through machine learning, the consolidation of multiple sources of data can contribute to computer models potentially able to support the prediction of the optimal investment in ripening time for use by the dairy industry."
Dairy Foods Symposium: Novel Technologies to Improve the Texture and Flavor of Cheese Symposium Dairy Foods - Novel Technologies to Improve the Texture and Flavor of Cheese 2024/06/17 09:15:00 t92004 Watch 1146 Use of high-casein powders in cheese. 6 P. Salunke high-casein powder,cheese,quality P. Salunke1 "Caseins (CN) are predominant milk proteins and play a significant role in cheese. Increasing CN in cheese milk is directly correlated with yield and quality. Additionally, many cheese manufacturers are interested in changing functional properties such as firmness, meltability, and other properties of cheeses. Hence, cheese manufacturers are interested in increasing CN in cheese milk through concentrated milk protein, including high-casein powders (HCP). Although there is no clear definition of HCP, ingredients with varying CN (18–92%) content are available, including whole or skim milk powder, nonfat dry milk, milk protein or micellar casein concentrate, milk protein isolate, rennet or acid casein powder, buttermilk powder, and other modified powders such as calcium or sodium caseinate. Each manufacturing technique yields HCP with unique constituents, including micellar CN, calcium, serum proteins, and lactose, which affect functionalities and may limit its usage in cheese production. Fresh or stored HCP and its functionality, especially solubility, play a significant role in cheese manufacturing. Depending on the type of cheese, the HCP can be added directly to the milk or curd during processing. For natural cheese manufacturing, the higher protein in cheese milk requires the processing and handling parameters to be modified or manipulated depending on the type of HCP used such as changes in pH, coagulation time, cutting time, moisture retention, curd handling, ripening, flavor development, and more. Increased protein content produces tough cheese curd and has higher fat loss in whey. However, incorporating HCP in cheeses such as soft cheese, direct acid and heat-coagulated cheeses, imitation, or processed cheese products is more manageable, and many cheeses can be manufactured using 100% HCP. Since the cheese curd can be tough, the curd handling equipment may need modification. Adding HCP may require labeling to be modified. Many HCP flavors may be transferred, impacting cheese sensory properties. The HCP may be preferred for cheese-type products in 3D-printed cheese applications. In conclusion, the proper selection of HCP and manipulation of cheese-making parameters can produce good-quality cheese."
Dairy Foods Symposium: Novel Technologies to Improve the Texture and Flavor of Cheese Symposium Dairy Foods - Novel Technologies to Improve the Texture and Flavor of Cheese 2024/06/17 09:15:00 t91114 Watch 1147 New instrumental techniques and approaches in understanding machinability of cheese. 7 P. Sharma instrumental techniques,cheese,machinability P. Sharma1 "Millions of kilograms of Cheddar cheese are sold in the United States each year. The cheese industry in the United States is growing at a 16% compound annual growth rate. In many cases, Cheddar cheese is sliced or shredded to use in various applications such as restaurant services and culinary dishes. During the process of slicing or shredding, problems such as loss of material can arise from cheese sticking to the moving parts of machinery or crumbling during high-speed operations. This wearing phenomenon can incur significant loss to cheese manufacturing operations. Currently, there is no objective way to determine or predict attributes of the machinability of Cheddar cheese from which these problems may arise. Sliceability is the ability of cheese to cut cleanly into thin slices, to resist breakage or fracture at slice edges, and also to undergo a high level of bending before breaking. On the other hand, shreddability is a comparable property to sliceability that includes several physical attributes such as ease of machinability of cheese, shape and integrity of shreds, absence of shredding defects such as propensity of shreds to mat or clump, and excessive production of fines. Intuitively, sliceability depends on the chemistry, microstructural, and rheological properties of the casein network. Good shredding or slicing behavior is observed in a relatively narrow range of textural properties and is not fully understood, or controlled, by cheese manufacturers. Poor performance of cheese during shredding or slicing would incur significant revenue loss to the cheese manufacturers. Understanding material response in a variety of conditions has been a subject of research in the past. Tribological (wear) behavior is believed to be closely related to machinability of cheese and can be used as a tool to predict slicing/shredding performance of Cheddar cheese. Similarly, tack force and tack energy measurements can be used to predict the tendency of cheese to stick to a metal blade. This talk will cover novel instrumental techniques and approaches in determining machinability of cheese."
Dairy Foods Symposium: Precision Components from Grass to Glass Symposium Dairy Foods 2024/06/17 13:30:00 s10632                
Dairy Foods Symposium: Precision Components from Grass to Glass Symposium Dairy Foods 2024/06/17 13:30:00 t91744 Watch 1204 Nutritional strategies to regulate the synthesis of milk components. 2 S. I. Arriola Apelo milk synthesis,insulin,serotonin S. I. Arriola Apelo1 "Milk is the only single food that provides all the nutrients required to sustain the rapid growth and development of the newborn mammal. After closing of tight junctions, mammary epithelial cells are responsible for the uptake or synthesis of the more than 2,000 chemical compounds found in bovine milk. Nutritional, hormonal, and neuronal signals coordinate the supply, transport, synthesis, and secretion of each of those compounds to guarantee narrow enough concentrations of the required nutrients to balance the nutritional needs of the newborn. Cellular transduction pathways further transfer systemic signals to the metabolic machinery in charge of transport, synthesis, packaging, and secretion. Technological advances in the measurement of mRNA, proteins, post-translational modifications, and metabolites have allowed a deeper understanding of the roles of systemic and cellular signals on milk component synthesis. We now understand that mammary cells do not simply transform circulating metabolites into milk components at a concentration-dependent rate, but rather communicate their demands systemically to modify organism behavior, growth, and metabolic capacity of specific systems and organs, and ultimately mammary substrate supply. In turn, mammary cells also respond to systemic signals adjusting their metabolic activity to systemic capacity. Insulin is an example of a systemic signal that communicates nutritional status to peripheral tissues. Through cellular membrane receptors and a cascade of cellular signals, insulin regulates fatty acid, carbohydrate, and protein synthesis, including in milk. However, insulin generates an unfair competition for mammary cells. Unlike in mammary cells, in adipocytes and myocytes, insulin also stimulates glucose uptake, reducing glucose supply for milk synthesis. In turn, milk-secreting cells synthesize serotonin, which inhibits insulin secretion from pancreatic β-cells, increasing nutrient availability for milk production. We will discuss nutritional strategies to alter the balance between systemic nutrient supply and mammary demands with the overall goal of increasing nutrient efficiency for milk production."
Dairy Foods Symposium: Precision Components from Grass to Glass Symposium Dairy Foods 2024/06/17 13:30:00 t91384 Watch 1205 Towards the future of next-generation dairy foods: A processing perspective. 3 G. Ozturk whey protein phospholipid concentrate,bioactive compounds,isolation G. Ozturk1 "Milk contains an abundance of bioactive compounds and essential nutrients, including the milk fat globule membrane (MFGM). The MFGM is a complex structure comprising approximately 40% lipids (e.g., phospholipids) and 60% proteins (e.g., glycoproteins). Each of these compounds has unique functionalities, such as promoting brain development, modulating the immune system, exhibiting antimicrobial properties, improving the growth of desirable gut bacteria, and reducing inflammatory and metabolic diseases. The dairy industry produces abundant bioactive compound streams that can be examined for their valuable functionalities. Whey protein phospholipid concentrate (WPPC) is a by-product of whey protein isolate production and reveals a source of many bioactive compounds that can benefit the immune system and gut health. We recently demonstrated that WPPC contained relatively higher levels of MFGM proteins, representing 23% of the total protein, and phospholipids accounting for 20% of the total fatty acid pool. These bioactive compounds derived from WPPC have the potential to be utilized as cutting-edge ingredients. Therefore, it is crucial to harness these streams through isolation and characterize these bioactive compounds, and more importantly, to develop methodologies to isolate these components in purity to enable detailed mechanistic investigations. However, our earlier research indicates that the production of WPPC might involve heat-induced formations of complexes between whey proteins and MFGM. Therefore, investigating changes that occur in the WPPC matrix during thermal treatment becomes essential. Specifically, understanding the alterations that occur in whey proteins due to different thermal treatments enhances the efficiency of isolating compounds such as whey proteins, milk fat globule membrane proteins, and phospholipids, all of which hold substantial nutritional and economic value."
Dairy Foods Symposium: Precision Components from Grass to Glass Symposium Dairy Foods 2024/06/17 13:30:00 t92038 Watch 1206 Effect of milk and its bioactive compounds on human health. 4 M. Bionaz milk,bioactive compounds,human health M. Bionaz1 "Milk is a very complex product. Besides the main components that are typically measured in milk, many bioactive compounds, both nutritive and non-nutritive, are present in milk. Some of those compounds have been known for a long time, such as fatty acids, but others have been recently discovered, such as exosomes that cargo proteins and oligonucleotides (e.g., miRNA), peptides, naturally occurring bacteria, oligosaccharides, phytochemicals, and a large number of signaling molecules. Studies both in vitro, in animal models, and in humans overall indicate a positive effect of milk to human health; however, the effect of each bioactive compound present in milk on human health is difficult to dissect, as the effective dose of each bioactive compound is seldom known, and the effect of one bioactive compound cannot be studied in isolation, as there is a complex interaction between the various bioactive compounds in milk as well as with bioactive compounds in other feed. For instance, despite the assumption that milk positively affects bone health, an obvious positive effect of milk consumption on bone growth is observed only when calcium is deficient in the diet. The effect of milk might not be seen immediately, as the effect may be long-term; this is suggested by the discovery that milk consumption can affect the transcriptome of mesenchymal stem cells, which in turn can affect obesity and bone health. The studies of bioactive compounds in milk have important repercussions for producers, processors, and consumers, as they can help improve the health quality of milk. Some bioactive compounds can be enriched in milk via dietary intervention on the lactating animals; for instance, the still poorly understood phytochemicals can be easily enriched in milk by grazing lactating animals in specialized pastures containing such phytochemicals. Some bioactive compounds can positively affect the health of lactating animals and be enriched in milk, such as polyphenols and unsaturated fatty acids. Reality always surprises us. Milk, this beautiful and complex reality, is still full of surprises and, thus, opportunities, that need to be unpacked."
Dairy Foods Symposium: Precision Components from Grass to Glass Symposium Dairy Foods 2024/06/17 13:30:00 t90843 Watch 1207 Role of MFGM in intestinal health. 5 R. Jimenez-Flores dairy food biochemistry,milk lipids,dairy bioactive components R. Jimenez-Flores1 "The milk fat globule membrane (MFGM) is a complex component of milk, and, in relation to relevance on dairy foods and human health, it is being defined as a biologically active part of milk. There is ample evidence and current research on the areas of cognitive development and gut-brain benefit with intervention of MFGM and the microbiome in the intestine. However, due to its complexity, there has not been a reductionist study that can pinpoint a single component as being responsible for this biological activity, nor a specific mechanism of action. There may not be an “only and single” component in MFGM that could be identified as a “silver bullet” for each health benefit ascribed to it. This is likely due to its origin and processing, having its structure and function dictated by lactation biology of the mammary epithelial cell, the physicochemical aspects involved in its natural function of engulfing every drop of milkfat, its tri-layer structure, and its natural evolutionary transformation to deliver nutrients and development signals to the mammalian neonate. Furthermore, this complexity is augmented by the way we process milk and the different methods for enriching this fraction in different dairy ingredients. In this presentation we will define the MFGM as a biological entity due to its origin, and we will summarize some of the methods used to enrich ingredients in MFGM. Then we will revise the latest information the scientific community has gathered in relation to the role that MFGM plays in maintaining and sometimes repairing intestinal health. However, this presentation will focus on evidence that the MFGM acts in part by regulating mucin production of goblet cells to ultimately enhance gut barrier function."
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 s10735                
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 t91173 Watch 1504 The regulation of colostrogenesis. 1 C. Baumrucker colostrogenesis,FcRn,transcytosis C. Baumrucker1 "Colostrogenesis is a unique phase of mammary epithelial cell differentiation occurring in the weeks before parturition and rapidly ending after birth in the bovine. What controls this process and how it accounts for the extreme variation of specific biologically active components that affect colostrum quality and neonatal health is the focus of new research. Among specific colostrum components whose concentrations exceed those in blood, immunoglobulin G1 (IgG1) is the only established marker of this mechanism. IgG1 is extremely variable in mass and concentration in cow colostrum. The Fc Receptor of the Neonate (FcRn; composed of FcGRT and B2M) is the major IgG and albumin binding protein that accounts for these proteins’ long half-lives in the circulation. The high occurrence of only IgG1 in colostrum represents selective transcytosis by the FcRn. Fluid phase uptake of extracellular components into mammary cells and their merger with sorting endosomes containing membrane bound FcRn will be described. The FcRn means of binding IgG with increased endosome acidity and transcytotic delivery of IgG1 while recycling IgG2 and albumin will be explained. The low pH of colostrum (pH 6.1) presents a dilemma because the release of IgG1 from FcRn requires a pH > 6.5. We have proposed that this release occurs in the endosome and is related to mammary synthesized lactoferrin (Lf, pKa 8.7), which appears after FcRn-IgG1 binding and sorting and provides the pH needed for disassociation. Endosome cargo secretion into colostrum must be different than that of casein, and mechanisms will be proposed. Both IgG1 and Lf, while being highly variable in colostrum, are correlated in concentration and mass. Finally, regulation of lactoferrin and FcGRT synthesis during colostrogenesis represent potential regulatory mechanisms that account for the extreme variation in colostrum quality."
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 t91680 Watch 1505 Optimizing passive immunity with dam vaccination: When is too soon or too late? What is too much? 2 A. R. Woolums vaccination,calf,colostrum A. R. Woolums1 "Dairy producers know that calves require high-quality colostrum given soon after birth to provide antibodies that protect calves from infection. Antibodies block infection by specific viruses or bacteria, and the cow’s colostrum only contains antibodies to viruses or bacteria the cow has been exposed to in the past, through natural infection or vaccination. This is nature’s way of helping the calf to be specifically protected from infections on the farm where they are born. It is possible to increase the concentration of antibodies to specific viruses or bacteria in newborn calves by giving cows a booster vaccination in the dry period. This dry period booster will increase the cow's blood antibodies, which then move into the colostrum. For dry cow vaccination to increase antibodies in colostrum, the cow must be boosted no sooner than 8 weeks before calving and no later than 3 weeks before calving. Booster vaccination in this window allows the cow’s immune response time to make antibodies and to move them into her colostrum. Many studies have shown that calves nursing colostrum from cows given booster vaccines in the dry period have higher antibodies in their blood for the first 1 to 3 mo after birth, compared with calves getting colostrum from cows not boosted in the dry period. Moreover, experimental infection of calves with bacteria or viruses in the vaccine indicates that higher antibody concentrations in the calves can improve their resistance to infection. However, when the effect of dry cow vaccination on naturally occurring disease on farms is evaluated, the positive effects of vaccination do not always translate to less disease in the calves. This may be because other factors such as hygiene, nutrition, and crowding have a bigger effect on natural disease occurrence than specific antibodies in the blood of the calves. However, only a small number of research studies have evaluated the effect of dam vaccination on naturally occurring disease in calves, and the available studies are small. More research in large field trials could improve understanding of how much dam vaccination can truly prevent calf disease."
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 t91497 Watch 1506 The impact of prepartum nutrition on colostrum production and newborn calves. 3 K. S. Hare colostrum,nutrition,calf K. S. Hare1,2, K. M. Wood2, G. B. Penner1, M. A. Steele2 "It is widely accepted that colostrum consumption is vital to newborn calves to enable their adaptation to the ex utero environment. Early consumption of high-quality colostrum supports the elevated metabolic rate of a newborn calf while promoting ontogenic development of their gastrointestinal tract and imparting the transfer of passive immunity. Colostrum quality is classically defined by its immunoglobulin G (IgG) concentration, but researchers are currently exploring the relative importance of other colostrum macronutrient and bioactive components to expand and provide a more nuanced definition of colostrum quality. Further, researchers aim to develop strategies for producers to modulate and improve colostrum composition to, ultimately, promote calf development. Manipulating feed intake before calving is a worthwhile approach since diet formulation can be readily adjusted. Early work demonstrated that both restricting or oversupplying nutrients relative to requirements reduced colostrum volume and IgG yield, importantly highlighting that prepartum nutrient intake can affect colostrogenesis. More recent research has focused on how the chemical composition of the prepartum diet can influence colostrum composition and yield. Substituting dietary starch in place of fiber, and altering the concentration and source of ether extract appear to have the most impact on colostrum composition and yield, while the effect of dietary protein content may be limited to the concentration and abundance of bioactive compounds in colostrum. Changes in the colostrum bioactive fraction due to prepartum nutritional management can occur independent of changes in the colostrum macronutrient composition and IgG concentration. The colostral bioactive fraction can affect the ontogenic development of newborn calves and, thus, should not be disregarded in instances where prepartum nutrient intake has marginal effects on other aspects of colostrum composition. By evolving our understanding of the relationship between prepartum nutrition and colostrogenesis in cattle, we may further support the health and development of newborn calves."
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 t90901 Watch 1507 Colostrum—More than immunoglobulin G (IgG): Colostrum components and effects on the calf. 4 S. Mann colostrum,calf,non-IgG S. Mann1 "Colostrum has long been recognized as the critical source of immunoglobulins (Ig) to achieve adequate transfer of passive immunity in the agammaglobulinemic bovine neonate. Although the importance of colostral Ig, particularly IgG, is clearly documented, colostrum is also rich in low-abundant proteins such as growth factors, cytokines, hormones, complement, antimicrobial peptides, and enzymes, as well as other active components such as maternal immune cells and microRNA. Insulin and insulin-like growth factors are present in amounts that are substantially higher than those circulating in blood of the dam and play a role in gut maturation. Heat treatment of colostrum before feeding is a management approach on dairy operations to control bacterial contamination and the potential transmission of infectious agents from the dam to the newborn calf via milk. Heat treatment has been shown to preserve the important IgG fraction. Recent research shows that certain colostral components are affected by the heating process and are reduced in concentration or viability, such as IgA, insulin, IGF, complement proteins, enzymes, and live cells. The inherent antimicrobial activity of bovine colostrum is also greatly reduced due to heat treatment whereas it appears to be preserved in frozen colostrum. This presentation will review the non-IgG components of bovine colostrum and their significance in the physiology of the newborn calf, as well as take into consideration the effects of postharvest treatments on these components."
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 t91954 Watch 1508 The role of colostrum in programming immune development of dairy calves. 6 L. Rostoll-Cangiano calf health,immune development,colostrum M. Cid de la Paz1, L. Rostoll-Cangiano1 "Neonatal calves are inherently susceptible to environmental pathogens as evidenced by the high incidence of mortality and morbidity during this phase of life. The placenta of the cow separates the maternal and fetal blood supplies, preventing in utero transmission of maternal leukocytes and immunoglobulins (Ig). As a result, calves are born immunologically naïve, and depend exclusively on colostrum for transfer of immunity to confer protection against environmental pathogens during the first weeks of life. Successful immune passive transfer via colostrum is one of the most important determinants of calf survival and can have long-lasting implications for health and productivity. While recent improvements have been made in colostrum management to minimize neonatal mortality and morbidity, studies and recommendations predominantly center on Ig transfer on calf health. However, while antibody-mediated protection is important, it is not the sole constituent of transferred immunity. In addition to Ig, colostrum is rich in growth factors, immune cells, and various bioactive molecules that collectively contribute to protecting against environmental pathogens while orchestrating the development of the nascent immune system of the calf. In this presentation we will discuss how colostrum can provide protection against both extra- and intracellular pathogens and how recent data suggest that it is instrumental in driving proper immune development, having long-term implications for animal health. Gaining a better understanding of the role of colostrum in shaping early life immune responses in calves can help us devise better management strategies to improve long-term health in dairy cattle."
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 t91043 Watch 1510 What can’t colostrum do? Exploring the effects of supplementing colostrum after the first day of life. 7 D. L. Renaud calf,health,preventive D. L. Renaud1, M. A. Steele1 "Recently, there has been renewed interest in colostrum, specifically in the days following birth. It has been found that supplementing transition milk or small quantities of colostrum, in addition to milk, for 3 to 14 d following birth can result in improved growth performance and reduced levels of diarrhea and mortality. Although the mechanisms behind these outcomes are not completely clear, they are thought to be the result of colostrum’s ability to stimulate intestinal development in dairy calves; however, addition work is needed to further elucidate the reasons for these effects. Furthermore, the optimal dose for supplementation is also unclear. Colostrum supplementation has also been explored as a therapy for disease. Specifically, when diarrheic calves were supplemented for 4 consecutive days with a colostrum and milk mixture, they had faster resolution of diarrhea and improved growth in the 56 d following the bout of diarrhea. Furthermore, when declines were noted in milk intake or drinking speed, measured by an automated calf feeder, colostrum supplementation for 3 d reduced the likelihood of developing respiratory disease, but not diarrhea, in the 7 d following intervention. Although few studies have been conducted exploring the therapeutic efficacy of colostrum, it shows promise as an antimicrobial alternative; however, more replication and further exploration of the mechanisms behind disease amelioration are needed. Finally, supplementation of colostrum has also been explored during stressful periods in the calf’s life. During the weaning process, colostrum supplementation, in addition to milk, was associated with improved growth, although no other differences, including on intestinal permeability, were observed. Based on the literature available, supplementation of colostrum after the first day of life using various strategies can lead to improved health and growth of dairy calves. That said, more replication of studies, along with more mechanistic studies, are needed to fully understand the full potential of colostrum."
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 t92132 Watch 1509 The utility of whole colostrum and components in maintaining gut health and metabolism. 8 J. F. Pierre colostrum,medical food,obesity K. Antunes1, C. T. Leathem1, N. B. Willis1, T. S. Mims1, N. Lazarevic1, D. Furstl1, E. McNiece1, C. Biebel1, S. Jamieson1, D. Wilbanks1, J. Lucey1, J. F. Pierre1 "Obesity is a major contributor to morbidity and mortality worldwide. Among contributing environmental and lifestyle causes, intestinal microbiome dysbiosis following antibiotics is linked with obesity through association and causality studies. In the United States, over 280 million antibiotics are prescribed annually, many to children. A common antibiotic class, macrolides, are necessary to treat common infections, but are linked to long-term risk of metabolic syndrome. In the sterile mammalian intestine at birth, colostrum serves as an initial food source, delivering nutritional components, but also concentrated bioactive metabolites (e.g., oligosaccharides, IgG) that shape optimal microbial colonization including Lactobacillus and Bifidobacteria, while limiting Enterococcus and pathogens. Given these bacterial genera are impacted by macrolide antibiotics, we hypothesized that therapeutic treatment with colostrum supplementation following antibiotic-induced microbial depletion would restore “eubiosis,” leading to more normal gut community functions. Our initial study evaluated the impact of colostrum therapy immediately following brief early life exposure to antibiotics, and we tracked metabolic phenotypes in mice over the lifespan at multiple time points. Initially, colostrum appears to stimulate epithelial barrier function, leading to goblet cell enrichment and increased mucosal microbial colonizers. Metabolically, treated animals maintained adipose tissue compartments and glucose tolerance similar to controls and without altering total dietary intake, while antibiotic treatment alone leads to greater total adiposity and impaired glucose tolerance. These results suggest colostrum or milk derivatives may be developed and optimized to provide useful medical food approaches in preventing chronic disease driven by antibiotic use."
Joint AAVI and ADSA Animal Health and Lactation Biology Committees Symposium: Colostrum—The Role it Plays in Calf Health, Development, and Future Productivity Symposium Animal Health 2024/06/19 09:15:00 n9119 Watch   Panel Discussion with all Speakers 9        
Joint American Society of Nutrition (ASN) and ADSA Symposium: Dairy and Dairy Products on Human Health Symposium ADSA Interdiscipline Symposia 2024/06/17 13:30:00 s10630                
Joint American Society of Nutrition (ASN) and ADSA Symposium: Dairy and Dairy Products on Human Health Symposium ADSA Interdiscipline Symposia 2024/06/17 13:30:00 t92080 Watch 1180 Whole-milk dairy and cardiometabolic health in humans. 1 R. Bruno full-fat dairy,cardiometabolic health,diet R. Bruno1 "Bovine dairy milk is a nutrient-rich matrix, but consumption of its full-fat variety has historically been discouraged due to its saturated fat and higher energy content that may provoke poor cardiometabolic health. However, continued investigation has provided evidence suggesting that whole-milk dairy consumption does not elicit the predicted detriments on cardiometabolic health. The objective of this presentation is to discuss whole-milk dairy and its implications on cardiometabolic health, considering evidence from observational studies, randomized controlled trials, and preclinical models. It will emphasize the health effects of dairy foods, as well as milk polar lipids, which are concentrated in the milk fat globule fraction and reported to alleviate metabolic dysfunction and promote gut barrier function. Understanding the totality of evidence surrounding the bioactivities and health benefits of whole-milk dairy is expected to support a framework for evidence-based dietary recommendations aimed at reducing the risk of cardiometabolic disorders and/or reversing their progression toward premature mortality."
Joint American Society of Nutrition (ASN) and ADSA Symposium: Dairy and Dairy Products on Human Health Symposium ADSA Interdiscipline Symposia 2024/06/17 13:30:00 t92130 Watch 1181 The dairy matrix and health benefits of dairy. 2 C. Weaver bioavailable minerals,vitamins,and essential amino acids C. Weaver1 "Dairy products are nutrient-dense foods that are rich sources of bioavailable minerals, vitamins, and essential amino acids that support growth and development and decrease risk of chronic disease. On a global scale, milk consumption is ranked very high compared with other food sources for bone-building nutrients: first for calcium, second for phosphorus and potassium, third for protein, and fourth for magnesium. Milk is also ranked among the top 3 foods contributing to the global intake of essential amino acids such as lysine, threonine, methionine, and tryptophan. There is growing current interest in the dairy matrix, the physiochemical structure, and its interaction with chemical constituents including nutrients. Emerging evidence suggests that the consumption of whole food matrix in dairy foods has health effects distinct from that of isolated nutrients. Dairy foods are sustainable as well as nutrient dense and are more affordable than plant-based beverage alternatives to milk."
Joint American Society of Nutrition (ASN) and ADSA Symposium: Dairy and Dairy Products on Human Health Symposium ADSA Interdiscipline Symposia 2024/06/17 13:30:00 t92207 Watch 1182 Milk: The Rosetta stone for health innovation. 4 J. B. German lactation,evolution,bioactivity J. B. German1,2 "The entire agriculture and food system is going through a revolution driven by the urgent need to meet the challenges of increasing sustainability of agricultural production and the challenges of improving human health through diets. These challenges are particularly daunting when one considers that the entire system may have to change without diminishing even briefly the massive productivity demands of feeding 8 billion people. Science itself is also challenged as it moves from a guiding a chemistry-based enterprise to a biotechnology-based system. Fortunately there is a magnificent biological model that combines the principles of sustainability and integrated diet: mammalian lactation. If we could understand scientifically how lactation manages to produce a comprehensive and sublimely nourishing diet for mammalian infants without compromising the health of mothers, we could transfer those same biological principles to the entire agriculture and food system of the future. Thus, scientific research and its translation needs to “decode” the language of lactation. Capturing the composition of milk will need to identify and quantify all of the dimensions of milk so that the functions can be assigned to molecules, structures, and mechanisms of action as an ensemble. Milk does not simply contain protein; it is a complex ensemble in which specific proteins, proteases, and anti-proteases act as a concerted, temporal, and spatial delivery system of proteins, catalysts, peptides, and amino acids. Similarly milk is not a simple source of fats but a profusion of globules, structurally complex and chemically diverse, with again an ensemble of catalytic activities that guide the disassembly of globules and the spontaneous assembly of complex structures within the infant. Milk is an extensively glycosylated biological fluid whose glycan structures and functions are only recently emerging. Just one of the roles of milk’s glycans is to feed and fuel a unique microbiological community within the lower intestine of the infant, as an astonishing example of evolutionary genius of structure to function. Milk is alive, with cells, enzymes, immune factors, and microorganisms. As life scientists, we owe it to lactation, the central and most defended gene set of mammals, to give its understanding the priority it deserves."
Joint American Society of Nutrition (ASN) and ADSA Symposium: Dairy and Dairy Products on Human Health Symposium ADSA Interdiscipline Symposia 2024/06/17 13:30:00 n9123 Watch   Panel Discussion 5        
Joint ARPAS and ADSA Growth and Development Committee Symposium: From Birth to Lactation Symposium Growth and Development 2024/06/17 09:15:00 s10594                
Joint ARPAS and ADSA Growth and Development Committee Symposium: From Birth to Lactation Symposium Growth and Development 2024/06/17 09:15:00 t91656 Watch 1148 Connecting the dots: Calving ease, age at first calving, and enhanced cow production. 1 M. I. Marcondes calving difficulty,milk production,modeling M. I. Marcondes1, J. C. C. Chagas2, A. F. Kertz3, T. Allen4, J. M. Bewley5 "Calving events are critical moments for dairies, with complications such as calving ease (CE) posing risks to cow performance and calf growth and development. A modeling approach was used to investigate relationships among CE, age at first calving (AFC), and production. Data came from 687 dairy farms (USA), comprising 1,048,574 CE observations (2017 to 2022). The CE was scored from 1 to 5 (Djemali et al., 1987). Breeds other than Holstein, Jersey, and dairy crosses (XD) were excluded. Outliers were excluded at 1% tails of data distribution, resulting in 794,870 CE. Lactation number (LN) was categorized as primiparous or multiparous. The study followed 3 steps. First, we evaluated the effect of CE on 305-d milk production (MP), energy-corrected milk (ECM), fat and protein, and milk at lactation peak (MLP). We used CE, LN, calf sex (CS), and dam’s breed as fixed effects, and calving year (CY), calving season (CSA), and herd as random effects. Second, an AFC database was used following the same criteria but keeping only primiparous cows (90,574 CE observations). For this step, AFC was adopted as linear and quadratic covariates, evaluating the same parameters as in the first step and considering the same fixed and random effects. In step 3, CE was studied as the response variable using the step 2 database, where AFC, CS, and breed were adopted as fixed effects, and CY, CSA, and herd as random effects. In step 1, the effect of CE and its interaction was observed with LN, breed, and CS for MP, ECM, fat and protein, and MLP (P < 0.01). Milk production and components were impaired by CE >2, and the lowest values were observed for cows scored CE = 4. The lowest MLP was observed for Holstein, Jersey, and XD scored CE = 4 (43.1, 35.8, 39.2 kg/d). In step 2, linear and quadratic components of AFC adopted as covariates were significant (P < 0.01). As a result, previously observed CE and their interactions were absorbed by the covariates. In step 3, CE was quadratically affected by AFC while also affected by breed and sex. Cows calving males showed higher CE, and the lowest CE was observed for Holstein at 27 and Jersey at 22 mo AFC."
Joint ARPAS and ADSA Growth and Development Committee Symposium: From Birth to Lactation Symposium Growth and Development 2024/06/17 09:15:00 t91755 Watch 1149 Exploring symbolic regression for body weight prediction in dairy calves. 2 E. Casella body weight prediction,computer vision,interpretability E. Casella1, G. J. M. Rosa1, J. R. R. Dorea1 "Monitoring heifer growth development is an important aspect of decision making in dairy farms, as a tool for health assessments, feed management, and breeding selection. Monitoring growth requires frequent body weight (BW) measurements; however, weighing calves is costly and labor-intensive. Computer vision and machine learning (ML) have been proposed as a powerful tool to predict BW in livestock animals. However, most ML techniques involve tuning a large number of parameters that increase the risk of overfitting in small data sets. Besides, these models lack interpretability and do not reveal biological associations between predictors and response variables. Symbolic regression (SR) is a ML approach that leverages genetic algorithms to find analytical equations and their coefficients to describe the output based on the input variables. In this study, we evaluated the use of SR versus gradient boosting trees (GBT) to predict BW in 67 pre-weaning Holstein dairy calves from 2 to 8 weeks of age, and BW of 57.0 ± 14.7 kg. A total of 400 3D images were captured from the dorsal area (top-down view) during weighing on a digital scale, and we extracted 27 biometric features from depth images (area, volume, length, 11 heights and widths along the dorsal area, eccentricity, and extent). Both SR and GBT were evaluated against observed BW using a nested cross-validation (5-fold for hyperparameter tuning and leave-one-out for testing). GBT achieved root mean squared error of prediction (RMSEP) = 7.7 kg, mean absolute error (MAE) = 5.8 kg, R2 = 0.59, and concordance correlation coefficient (CCC) = 0.78. Among the frequently high-ranked equations we found (1) BW = a + b × Volume, (2) BW = √Area + Width6, and (3) BW = (Width5 + c)d. The median values for a, b, c, and d were 31.53, 0.22, 12.14, and 1.16. SR presented better predictive performance than GBT, with (1) presenting RMSEP = 6.0, MAE = 4.9, R2 = 0.67, and CCC = 0.86. While further investigations are needed on more heterogeneous data sets, SR shows the potential to predict BW using simple linear and nonlinear equations that may generalize well, with low computational cost, and with the benefit of interpretability."
Joint ARPAS and ADSA Growth and Development Committee Symposium: From Birth to Lactation Symposium Growth and Development 2024/06/17 09:15:00 t90949 Watch 1150 Factors influencing colostrum production in multiparous Holstein and Jersey cows at multiple locations. 3 P. S. Erickson colostrum,Jersey,Holstein P. S. Erickson1 "Feeding adequate amounts of good-quality colostrum after parturition is essential to the health and production of the future dairy herd. Colostrum quality, amount fed, and feeding time are known factors that have far-reaching impacts on animal performance. However, recently it has come to light that some Holstein and Jersey cows underproduce colostrum. Therefore, the purpose of this review is to evaluate the current research regarding factors influencing colostrum yield, quality, and immunoglobulin G (IgG) yield. Regression models were developed using environmental factors and previous lactation data including previous lactation 305 ME milk yield, milk component content and yield, and somatic cell count. Management factors included were previous days open and days dry, ordinal day, time of colostrum harvest relative to calving, parity, diet characteristics, number of dry cow feedings per day, and amount of time grazing. Farm-specific factors included the latitude of the farm and herd size. Specific to Holstein cows the number of days above the thermoneutral zone increased colostrum yield (P < 0.01) but negatively affected IgG/L (P < 0.01). Results for Jersey cows indicated that previous days open and previous days dry were positively associated with colostrum and IgG yields (P < 0.02). While the latitude of the farm was negatively associated with colostrum and IgG yields (P < 0.01). The respective models’ ability to predict their respective outputs in comparison to actual colostrum production values will be presented. The results of this review may direct researchers to areas of study that will help decrease this colostrum production challenge."
Joint ARPAS and ADSA Growth and Development Committee Symposium: From Birth to Lactation Symposium Growth and Development 2024/06/17 09:15:00 t91967 Watch 1151 Unlocking the “potential” of bovine fetal mammary stem cells. 4 A. Schiffmacher mammary stem cell,fetal development,multipotency T. Podles1, H. Burchard1, A. Schiffmacher1 "Bovine mammary stem cell technologies can facilitate new methods to advance dairy animal health, growth, and performance. As early fetal mammary epithelial cells exhibit multipotency and give rise to all adult mammary gland tissues, we hypothesize that understanding fetal mammary development is critical for advancing bovine mammary stem cell research. Our objectives are to (1) identify gene regulatory networks governing fetal bovine mammary stem cell potential and (2) develop mammary stem cell tools that will benefit animal health and production. To ascertain when the stem cell niche forms, fetal bovine mammary tissues purchased from Applied Reproductive Technology (Madison, WI) were microdissected and partitioned into experimental groups by stage and crown-rump length (CRL, n = 5 fetal tissues per stage: hillock/bud, 21–88 mm; bud/teat, 81–120 mm; primary sprout, 120–160 mm; and secondary sprout, 161–230 mm). TRP63 and cytokeratin (14, 5, and 8) immunolabeling indicate that luminal/basal lineage segregation occurs before sprouting when P63+ cells segregate to the outer layer and inside luminal cells exhibit reduced TRP63 and CK14 immunolabeling relative to outer cells (no difference vs. differential inner/outer layer immunolabeling, chi square analysis, PROC FREQ, SAS). Multiplex fluorescent RNA in situ hybridization experiments reveal that early bovine mammary bud cells co-express specification (LEF1, SOX11), luminal (SOX9, ELF5), and basal (TRP63, LMO4) factors, indicating that they remain uncommitted yet transcriptionally primed for differentiation. Cell lines derived from fetal mammary epithelia (9 primary lines, 50 mm to 170 mm CRL) were generated via conditional reprogramming culture (irradiated 3T3J2 cells and 10 µM Y-27632 ROCK inhibitor). Lines have been propagated over 5 passages (5- to 7-d passage frequency). Together, this work will allow us to characterize fetal mammary stem cell stemness and provide new models for understanding mammary reprogramming due to gestational influences (heat stress, malnutrition)."
Joint ARPAS and ADSA Growth and Development Committee Symposium: From Birth to Lactation Symposium Growth and Development 2024/06/17 09:15:00 t91178 Watch 1152 The weaning transition in dairy calves: Why so traumatic? 5 J. K. Drackley weaning,starter feed,rumen development J. K. Drackley1 "The weaning transition imposes many stressors on dairy calves, often compromising welfare and performance. These stressors include nutritional inadequacy, along with environmental and social stresses. According to the National Animal Health Monitoring System (2014), producers are feeding more milk, and death loss has decreased in pre-weaning calves, but growth post-weaning is often sub-optimal. Diseases such as respiratory disease and coccidiosis are common in newly weaned calves. Why is this period so often traumatic for the calf? The proportion of empty BW to BW decreases during the weaning transition, so that gut fill increase may contribute over 25% of measured BW gain. The gastrointestinal tract mass increases allometrically during the weaning transition, requiring large quantities of energy and amino acids. Starter intake before weaning is the largest determinant of growth and health post-weaning. Intake of starter drives rumen microbial and papillae development. Typical guidelines for adequate starter intake to allow weaning may only cover maintenance requirements. With larger volumes of milk fed before weaning, starter intake, and hence rumen development, is slower to develop than in situations in which less milk is fed. Key factors to help avoid poor weaning outcomes by having adequate rumen development include not weaning too early, weaning gradually, not allowing free access to alfalfa forage, feeding a high-quality starter, good water management, and not stacking stressors at weaning."
Joint CSAS and ADSA Breeding and Genetics Committee Symposium: Beefing Up Dairy—Exploring the Advantages of Beef-on-Dairy Symposium Breeding and Genetics 2024/06/17 09:15:00 s10622                
Joint CSAS and ADSA Breeding and Genetics Committee Symposium: Beefing Up Dairy—Exploring the Advantages of Beef-on-Dairy Symposium Breeding and Genetics 2024/06/17 09:15:00 t91127 Watch 1127 Nutritional management of crossbred calves: Can they be a sustainable source of beef? 1 M. A. Steele crossbred,calf,nutritional management M. A. Steele1, T. Chapelain1, M. Kovacs1, H. McCarthy1, D. L. Renaud2 "In the past decade there has been a dramatic increase in the use of beef sires on dairy cows, efficiently generating more cattle for the world beef sector. Crossbred calves from dairy farms undergo a dramatically different rearing system compared with native beef, especially with respect to nutrition in early life. Native beef is reared with their dams and fed ad libitum milk and weaned after 6 mo of life. Conversely, crossbred calves are separated from their dam at birth, fed restricted levels of milk replacer, weaned before 2 mo of age and offered high-concentrate diets until slaughter. These dramatic differences in early-life nutritional management may lead to large differences later in the life, which may impact meat production and quality and lead to health challenges. Since crossbred calves are reared artificially, there are several opportunities for management intervention throughout life to improve health, productivity, and carcass quality. For example, pregnant dairy cattle can be offered specific nutrients and diets to prenatally program calves for desirable phenotypes compared with the traditional beef cow-calf farm. Furthermore, the macro- and micronutrients of milk and concentrates can be altered to program desirable outcomes in early life and during the finishing period. The opportunities for management interventions with crossbred calves, especially nutritional interventions, provide more flexibility to quickly adapt to market demands, in both product quality and sustainability aspects."
Joint CSAS and ADSA Breeding and Genetics Committee Symposium: Beefing Up Dairy—Exploring the Advantages of Beef-on-Dairy Symposium Breeding and Genetics 2024/06/17 09:15:00 t91707 Watch 1128 Insemination trends and the rise in beef and sexed sire semen in North America. 2 A. Fleming beef-on-dairy,beef semen,sexed semen A. Fleming1, H. Sweett1, B. Van Doormaal1, F. Miglior1,2 "The dairy industry is rich in innovation, influencing the decisions producers need to make to help accelerate their herd sustainability and profitability. The wide availability and improved conception success of sexed semen have contributed to its increased usage within the last decade. In Canada, for the Holstein breed, sexed semen represented approximately 18% of inseminations in 2023, up from 4% in 2016. Sexed semen permits greater control of replacement heifers and improved breeding strategies. Top females in the herd can be bred using sexed semen to greatly increase, to about 95%, the probability that progeny will be female and the best genetics contribute to the next generation of the milking herd. With fewer pregnancies needed to yield replacement dairy heifers, there has been an associated increasing trend in beef sire semen to produce dairy beef crossbreds, translating to higher profits generated through surplus calves. In over 25% of Holstein cow inseminations in 2023 the service sire was a non-dairy breed, with Angus emerging as the dominant beef sire breed used. Traits prioritized in beef sire selection by dairy producers include fertility and calving traits to ensure successful pregnancy and easy calvings. Of lesser importance may be the selection of high genetic merit bulls for growth and carcass traits if there is little motivation to do so. Dairy data collection and storage centers accumulate insemination, fertility, and calving records for beef-on-dairy matings alongside traditional data. These data can be leveraged to discern the performance of sires, existing trends, and the producer’s decision-making when applying beef-on-dairy strategies. National dairy genetic evaluation centers typically lack pedigree information and genotypes on beef sires and performance data on the crossbred calves once they leave the dairy. To address this gap, existing systems for beef sire evaluations could be expanded through collaborative efforts, providing dairy producers with essential information to identify optimal beef sire genetics for mutual benefit of the 2 industries."
Joint CSAS and ADSA Breeding and Genetics Committee Symposium: Beefing Up Dairy—Exploring the Advantages of Beef-on-Dairy Symposium Breeding and Genetics 2024/06/17 09:15:00 t90975 Watch 1129 Beef-on-dairy? Ireland has been doing that since flip phones were cool. 3 D. P. Berry dairy-beef,breeding,genetics D. P. Berry1 "Reasons for the intensifying interest in beef-on-dairy include (1) improving reproductive performance of dairy females necessitating fewer replacements, (2) growing use of X-bearing dairy sexed semen resulting in fewer dairy females required to generate replacements, (3) dairy herd expansion being curtailed or reversed in some territories, (4) exploitation of possible heterosis from crossbred embryos, (5) maintaining resilience to volatility in milk price as well as providing a highly liquid asset, (6) exploiting the greater market opportunities relative to dairy × dairy calves, and (7) mitigating mounting consumer concerns of fate of male dairy calves. The traditional fragmentation of Irish dairy farms also favors the retention of a beef enterprise on farm. Successful beef-on-dairy systems are predicated on a successful national and herd breeding program. All bovine data in Ireland are stored in a centralized database managed by a nonprofit organization, the Irish Cattle Breeding Federation. This enables across-breed genetic evaluations but also provides a single source of the truth for all actors in the beef-on-dairy pipeline. A single, across-breed, national beef-on-dairy breeding index is available on all male beef animals in Ireland; the goal of this index is to help dairy farmers identify beef bulls suitable for mating to their dairy females but also beef seedstock breeders interested in breeding bulls for the dairy market. Through the national infrastructure, dairy farmers have access to a sire advice mating tool which suggests matings between beef bulls and dairy females. A commercial beef value index is generated for each genotyped calf, which is made publicly available at the time of auction. Currently the prediction of future profit of each calf represented by its commercial beef value is based on additive genetic merit. Importantly, though, a strong correlation exists between the beef-on-dairy breeding index used for mating and the commercial beef value of the resulting progeny; the data used to populate both indexes originate from the same reliable source—the difference between the indexes is that the commercial beef value does not contain calving performance."
Joint CSAS and ADSA Breeding and Genetics Committee Symposium: Beefing Up Dairy—Exploring the Advantages of Beef-on-Dairy Symposium Breeding and Genetics 2024/06/17 09:15:00 t91880 Watch 1130 Beef-on-dairy, sexed semen, and IVF. A producer prospective. 4 M. Bowers beef × dairy,genetics,producers M. Bowers1 "The dairy industry is continuously evolving to meet the growing demand for both milk and beef production. To optimize milk yield while improving the quality and productivity of beef progeny, advanced breeding strategies play a pivotal role by facilitating the selection of desired traits and accelerating genetic progress within the herd. Sexed semen technology offers precise control over offspring sex, enabling producers to make strategic mating decisions that maximize the production of beef progeny from dairy dams. By using sexed semen, producers can tailor their breeding strategies to meet market demands and increase profitability. This technology has transformed the dairy industry by providing a new level of control over breeding outcomes, allowing producers to reduce the number of replacement heifers and increase the number of beef calves produced from the dairy herd. By examining the producer perspective, we will explore the most commonly used breeding strategies and the role of advanced reproductive technologies, such as sexed semen and IVF. In particular, we aim to provide insights into the opportunities and challenges associated with adopting these advanced breeding techniques in the context of beef-on-dairy systems."
Joint CSAS and ADSA Breeding and Genetics Committee Symposium: Beefing Up Dairy—Exploring the Advantages of Beef-on-Dairy Symposium Breeding and Genetics 2024/06/17 09:15:00 n9081 Watch   Panel Discussion 5 Francesca Malchiodi      
Joint DCWC and ADSA Animal Behavior and Well-being Symposium: Elevating Animal Comfort and Well-being Using the Five Domains Symposium Animal Behavior and Well-Being 2024/06/18 09:15:00 s10688                
Joint DCWC and ADSA Animal Behavior and Well-being Symposium: Elevating Animal Comfort and Well-being Using the Five Domains Symposium Animal Behavior and Well-Being 2024/06/18 09:15:00 t90822 Watch 1300 Explaining the Five Domains and using behavioral measures in commercial systems. 2 T. Grandin animal welfare,animal health,behavior T. Grandin1 "The Five Domains Animal Welfare framework is now being used by many corporate buyers as the framework for animal welfare auditing programs. It is gradually replacing the Five Freedoms. Some commercial buyers have made this switch because it is not possible for an animal to be completely free from fear, distress, injury, or disease. For example, it is nearly impossible to have zero lame dairy cows. The percentage of severely lame dairy cows should be very low, and producers can work on continuous improvement to further reduce lameness. Another reason the Five Domains are being more widely adopted is that preventing distress or suffering is not always possible, nor is it sufficient. The animal should also have positive experiences and a life worth living. The Five Domains are (1) nutrition, (2) environment, (3) health, and (4) behavior, all of which will influence animals’ (5) affective state. The first 3 domains are similar to Good Feeding, Good Housing, and Good Health from the European Welfare Quality System. The fifth domain (affective states) cannot be easily measured. In the Five Domains, the behavior domain has 3 parts. Each behavior category has both negative and positive behaviors that can be quantified. The 3 behavior components are as follows. Cow interactions with the environment: Such as quality of and access to resting spaces or access to a powered grooming brush. Cow interactions with people: Both positive and negative during handling and milking. Cow interactions with other animals: Such as fighting or allo-grooming. Some typical measures that would be used on the farm to assess nutrition, environment, and health are clean water, body condition, hygiene-scoring swollen hocks, falling on a slick floor, lameness, sickness, and lack of pain control for painful procedures. These are all key welfare indicators that can be assessed with ease to quantify outcome measures."
Joint DCWC and ADSA Animal Behavior and Well-being Symposium: Elevating Animal Comfort and Well-being Using the Five Domains Symposium Animal Behavior and Well-Being 2024/06/18 09:15:00 t91566 Watch 1301 Measuring minds: Understanding the mental states of dairy animals in different management conditions. 3 H. W. Neave emotional state,animal personality,positive animal welfare H. W. Neave1 "A key tenet of good animal welfare and a high quality of life is that animals experience positive emotional states, while negative emotional states are minimized. The assessment of emotional and mental states in animals remains difficult, but nonetheless is crucial for understanding how animals experience their life under farm management conditions. This presentation will provide some examples of behavioral, cognitive, and physiological methods for assessing emotional states in animals, with examples from dairy cattle and goats experiencing different management conditions. For example, cognitive bias tests and body language can reveal the emotional states of cows managed with or without their calves; anticipatory behavior demonstrates sensitivity to rewards when calves are housed in barren or enriched pens; and infrared thermography and decision-making tasks can inform about environmental conditions that goats like or avoid. Animal personality is also highly relevant to the discussion of mental states, as personality traits play a role in how individuals interact with and respond to challenges that are often stressful in their management environment. For instance, more exploratory dairy calves perform better around weaning; more fearful dairy goats are less likely to access the feed bunk during competition; and more curious dairy cows spend more time grazing and produce more milk. Together these examples demonstrate how different management conditions may positively or negatively affect the emotional states of animals, and how personality traits influence the way animals respond to stressful management practices. An understanding of and efforts to measure these mental states provide opportunities to tailor management practices to meet individual needs and improve animal welfare."
Joint DCWC and ADSA Animal Behavior and Well-being Symposium: Elevating Animal Comfort and Well-being Using the Five Domains Symposium Animal Behavior and Well-Being 2024/06/18 09:15:00 t90863 Watch 1302 Importance of human-animal relationships and their influence on animal welfare and productivity. 5 M. C. Ceballos handling,training,HAR M. C. Ceballos1 "Human-animal relationships (HAR) have existed since the Neolithic period, parallel to the domestication of many animal species. Establishing an HAR is a gradual process, strengthened by repeated interactions. Animals can develop relationships with humans with a long-lasting and integrative nature based on their ability to remember and predict future interactions. It is well documented that negative HAR can impair animal welfare, primarily through fear as an underlying mechanism, with negative consequences on animal health and productivity, including reductions in fertility and milk quantity and quality. Conversely, positive interactions with humans lead domestic animals to seek and engage with us, yielding intrinsic rewards for animals. However, our understanding of processes underlying positive perception of humans needs further research. In the recently updated Five Domains model, Domain 4, now called Behavioral Interactions, was extended to facilitate explicit and detailed assessment of humans’ impact on welfare of animals in their care, reinforcing its importance to animal welfare. Some routine tasks on farms are aversive but are difficult or impossible to replace (e.g., vaccinations, transport); therefore, they should be done in the best possible and least aversive ways, minimizing unnecessary animal suffering. Furthermore, stockpeople may have misguided opinions and behaviors that are usually not due to intentional unkindness but rather from a lack of knowledge. On many farms, turnover rates for stockpeople are high, and there is limited investment in training. This creates a challenging cycle where insufficiently trained employees often have only short-term employment, reinforcing producers’ reluctance to invest in their training. However, research in dairy and beef production systems has demonstrated the benefits of training programs incorporating behavioral and cognitive techniques to enhance stockpeople’s attitudes and behavior toward animals and decrease animals’ fear toward humans. Improving animal handling yields numerous benefits for both animals and workers, improving welfare and productivity for both."
Joint DCWC and ADSA Animal Behavior and Well-being Symposium: Elevating Animal Comfort and Well-being Using the Five Domains Symposium Animal Behavior and Well-Being 2024/06/18 09:15:00 t91596 Watch 1303 Demonstrating U.S. Dairy’s commitment to animal care. 6 E. Yeiser Stepp animal welfare,supply chain,consumer perception E. Yeiser Stepp1, C. DeCoite2, B. Hampton Phifer1, S. Roche3, J. Saraceni3 "The National Dairy Farmers Assuring Responsible Management (FARM) Program is the US dairy industry’s national quality assurance program. The goal of FARM is to assist US dairy farmers, cooperatives, and processors in providing assurance to dairy buyers and consumers that dairy farmers care for their animals, workforce, and land in a responsible manner. FARM Animal Care encompasses voluntary participation from 99% of the US milk supply. The program sets industry standards with a few guiding principles: scientific research, facility and size neutrality, and outcomes-based standards. The focus of the program is to promote and ensure a strong veterinarian-client-patient relationship (VCPR), employee training and continuing education, care for high-risk animals, and animal observations. Noncompliance with standards that fall into these focus areas result in corrective actions. The program has seen strong compliance to standards related to animal and facility observations, and antibiotic stewardship. Opportunity areas exist related to documentation efforts (i.e., veterinary oversight, treatment records, cow care agreements, and employee continuing education). Management-related areas for improvement include the use of pain management for disbudding and injured tails. Nearly 85% of US dairy top-tier customers (brands, restaurants, retailers, and distributors) support the FARM Animal Care program through procurement requirements, global sourcing frameworks, and social responsibility commitments. This is a testament to the commitment of US dairy to have a program that is grounded in science, transparent in standards development, and maintaining relationships with key customers. Still, interest by these companies to differentiate themselves in the marketplace and address consumer concerns grows. Moving forward, animal welfare research, which is utilized to develop future FARM and global framework standards, must prioritize key areas of customer and consumer interest (i.e., painful procedures, freedom of movement, pharmaceutical use, and natural behaviors) with a lens on practical and economic feasibility for farmer implementation."
Joint EAAP and ADSA Breeding and Genetics Committee Symposium: Breeding for Environmental Sustainability Symposium Breeding and Genetics 2024/06/18 09:15:00 s10687                
Joint EAAP and ADSA Breeding and Genetics Committee Symposium: Breeding for Environmental Sustainability Symposium Breeding and Genetics 2024/06/18 09:15:00 t91300 Watch 1312 The value of a national evaluation system in promoting dairy sustainability. 1 A. M. Miles sustainability,genetics,breeding A. M. Miles1, K. L. Parker Gaddis2, R. H. Fourdraine3 "Sustainability is best defined as a balance of practices that promote economic vitality, protect the natural environment, and build healthy communities in the present without compromising the future. The dairy industry has seen tremendous gains in productive efficiency following decades of work with these goals in mind. A major tool contributing to this progress is the National Cooperator Database (NCD), which was developed in partnership with key industry groups. Involving a complex system of management and both domestic and international data sharing, the NCD now encompasses over 8.5 million genotypes, 90 million pedigrees, and 100 million lactation records. The primary outputs of this system are national genetic and genomic evaluations that are delivered to participants tri-annually. A comprehensive database with high participation from dairy herds can have additional impact. Greater genetic gains have resulted in a faster inbreeding rate, a well-established antagonist to cow health and performance. The marketability of sires with high genetic merit limits male genetic variation, so conserving female genetic diversity must be a top priority. With dairy genetics being traded all over the world, the NCD enables the monitoring of inbreeding at the global population level. Dairy systems are continually evolving thanks to technology advancements, changing consumer values, and resource availability. Frequent interrogation of the NCD can facilitate the early detection of changing industry trends such as the rise in embryo transfer or the popularity of beef-on-dairy to sustain farm profits. These changes impact the accuracy of existing evaluations (e.g., fertility), and also highlight the need for improvement tools that are just as dynamic as the dairy industry. An industry-wide effort is underway to develop a herd-level sustainability metrics platform that would support dairy producer ability to farm and track their progress in key health and production areas. This pre-competitive collaboration among dairy industry groups ensures the reliable flow of accurate data so we can continue to develop tools to support the dairy producer in the present and future."
Joint EAAP and ADSA Breeding and Genetics Committee Symposium: Breeding for Environmental Sustainability Symposium Breeding and Genetics 2024/06/18 09:15:00 t91338 Watch 1313 Breeding for improved heat tolerance: Methods, challenges, and progress. 2 I. Misztal heat stress,genetics,management I. Misztal1 "Heat tolerance in dairy cattle likely deteriorates over time due to unfavorable correlations between production and heat tolerance, with stronger deterioration in later parities. Coupled with climate change, heat stress is felt in increasingly colder areas. The industry has responded to the challenge of heat stress by applying managemental modifications, such as better cooling devices, timed AI, and sexed semen. Cooling devices are justified in areas with a long hot season and high milk prices, and less so otherwise. Methodology exists to calculate GEBV for high production under heat stress, with high reliabilities under the genomic selection. However, cows that maintain production during the peak of the heat stress may be more likely to be disposed of, and detrimental effects of calving during the peak of the heat cycles can be permanent. One remedy would be selection for better fertility and survival under heat stress, but with low volume of data and low heritabilities, corresponding reliabilities may be too low for an efficient selection. In environments where intensive management is too expensive, an ideal cow would maintain production during a favorable weather, would reduce production during heat stress, and would restore production after the stress is over. Such a resilient cow could be identified by larger-than-expected fluctuations in production during the lactation. A special effort would be required to separate the desired fluctuations to cope with the heat stress, versus undesired fluctuations due to health issues (canalization)."
Joint EAAP and ADSA Breeding and Genetics Committee Symposium: Breeding for Environmental Sustainability Symposium Breeding and Genetics 2024/06/18 09:15:00 t92045 Watch 1314 Strategies for breeding of feed-efficient dairy cows with lower methane emissions. 4 B. Heringstad environmental impact,feed intake,genetic evaluation B. Heringstad1, K. A. Bakke2 "To meet future challenges, we should breed feed efficient cows that have lower methane emissions. The motivation for improving feed efficiency is high because feed costs are the largest cost in dairy production, reported to be more than 60% of the variable costs. At the same time the agricultural sector is expected or committed to reduce the environmental impacts of food production. By including new traits in the breeding goal we can save feed costs and at the same time reduce methane emissions from dairy production. Feed efficiency and methane emissions are challenging traits in dairy cattle, traits that are difficult, costly, and time- and labor-intensive to collect. However, reliable phenotypes are crucial for success. Strategies for genetic selection include direct selection and indirect selection using indicator traits or prediction equations based on, for example, mid-infrared spectra in milk. In any case, large-scale phenotyping of individual feed intake and methane emissions is needed. This is established in research herds and in commercial herds in many countries. These projects and initiatives will build reference populations for genomic evaluations, and the growing database of phenotypes of key parameters makes it possible to develop the tools needed for successful implementation. Results so far indicate that there is substantial genetic variation for methane emission, roughage intake, dry matter intake, and different measures of feed efficiency, and breeding for these traits is feasible. More knowledge is needed on the genetic associations between traits, and further research is needed to examine which trait definitions would be better for successful implementation in the breeding programs. The aim should be to balance feed efficiency, climate effects, production, health, and fertility in a sustainable breeding goal for the future."
Joint EAAP and ADSA Breeding and Genetics Committee Symposium: Breeding for Environmental Sustainability Symposium Breeding and Genetics 2024/06/18 09:15:00 t91150 Watch 1315 Genomic and epigenomic strategies for dairy breeding sustainability. 5 H. Jammes epigenetics,environment,adaptation H. Jammes1,2, G. Costa Monteiro Moreira1,2, V. Costes3, H. Kiefer1,2 "The livestock sector is a pillar of the global food system, supporting the food and nutrition security of nearly 1.3 billion people according to the FAO. Faced with global environmental changes, the health and fertility of farm animals are of paramount importance: they constitute the right way to maintain well-being and metabolic homeostasis while improving production in quality and quantity in variable environments. Genomic selection increasingly considers phenotype indicatives promoting robust and efficient animals. Nevertheless, environmental pressure on livestock is increasing and occurs throughout an individual’s life; in this context, the full importance of epigenetic processes, such as DNA methylation, becomes clear, as they are needed for the development of the individual and serve as a memory of environmental events. Different examples will be presented to highlight the contribution of epigenetic process driving the phenotypes. First, to predict bull fertility, we studied epigenetic quality of semen variations in relationship with different intrinsic (age; breeding) and extrinsic (nutrition) factors. Using a unique collection of 100 sperm samples, it was demonstrated that the bull sperm methylome was a valuable source of male fertility biomarkers. DNA methylation changes in blood immune cells were also determined in response to various factors (age, nutrition, inflammation, heat stress) and used as biomarkers to diagnostic the individual health. A tool known as “epigenotyping,” taking into account of all identified biomarkers combined with biomarkers selected from public data and genome annotation, is in progress (https://rumigen.eu) and will be presented, as well as the opportunities that this tool offers. Finally, the progress of annotation of functional genome elements in livestock animals (the FAANG initiative) and the utility of generated information (enhancers, promoters, insulators, small and large RNA transcripts) will be presented. All approaches taken together may improve the understanding of genome function as an adaptative response to environment."
Joint Reproduction and Physiology and Endocrinology Symposium: Physiology and Management of Previously Inseminated Cows: Approaches for Reinsemination Symposium Reproduction 2024/06/18 09:15:00 s10691                
Joint Reproduction and Physiology and Endocrinology Symposium: Physiology and Management of Previously Inseminated Cows: Approaches for Reinsemination Symposium Reproduction 2024/06/18 09:15:00 t91337 Watch 1340 Management strategies for reinsemination: An integrative approach. 2 P. M. Fricke nonpregnancy diagnosis,pregnancy loss,Resynch P. M. Fricke1 "In contrast to first artificial insemination (AI), submission of cows for second and greater AI requires coupling a nonpregnancy diagnosis with a management strategy to rapidly resubmit nonpregnant cows for reinsemination. Although an early nonpregnancy diagnosis can improve reproductive efficiency by decreasing the interval between AI services, the high rate of early pregnancy loss in lactating dairy cows limits the effectiveness of early resynchronization strategies based on an Ovsynch protocol (i.e., Resynch). One of the first Resynch studies aimed to identify the optimal interval from first timed AI (TAI) to initiation of a Resynch protocol to optimize fertility. Variation in cycle length among individual cows and the high frequency of early pregnancy loss, however, extends the interval between inseminations and increases variation in return to estrus after AI. Accurate identification and insemination of cows that return to estrus after AI is a practical and early method for nonpregnancy diagnosis in dairy herds that is facilitated by automated activity monitoring systems. A key factor affecting fertility to a Resynch protocol is the presence or absence of a corpus luteum (CL) and hence circulating progesterone concentrations at the onset of the Resynch protocol. Based on these collective findings, a common Resynch strategy is to identify and AI cows that return to estrus after AI and pre-treat all cows with GnRH 7 d before a pregnancy diagnosis conducted with transrectal ultrasonography at 25 or 32 d after TAI. Nonpregnant cows are identified 1 wk later at 32 or 39 d after TAI using transrectal ultrasonography and are segregated based on the presence or absence of a CL. Nonpregnant cows with a CL complete the Resynch protocol, whereas nonpregnant cows without a CL reinitiate a Resynch protocol that includes an intravaginal progesterone insert. This strategy has led to increased fertility to Resynch protocols used on commercial dairy farms. Future research should be aimed at developing practical and accurate methods for early nonpregnancy diagnosis and further refining Resynch strategies. Supported by WI Experiment Station Hatch project WIS04012."
Joint Reproduction and Physiology and Endocrinology Symposium: Physiology and Management of Previously Inseminated Cows: Approaches for Reinsemination Symposium Reproduction 2024/06/18 09:15:00 t91552 Watch 1341 Ovarian physiology of previously inseminated cows: Considerations for rebreeding. 3 J. O. Giordano ovarian function,resynchronization,detection of estrus J. O. Giordano1 "Successful reproductive programs for dairy cows include a reinsemination strategy that minimizes the interbreeding interval (IBI) and maximizes pregnancies per artificial insemination (P/AI). Unique challenges of reinsemination programs (Re-AI) include the detrimental effects of early pregnancy loss (PL) on ovarian function and the need to determine pregnancy status before resynchronization protocols can be completed. The effects of PL on ovarian function have negative consequences not only on Re-AI at detected estrus (AIE) but also on hormonal interventions to resynchronize ovulation. Delayed corpus luteum (CL) regression has long been recognized as a major contributor to the variability in return to estrus in previously inseminated cows. Novel methods to monitor in more detail markers of early conceptus development (interferon stimulated genes, pregnancy-associated glycoproteins) and methods to characterize the CL and follicular wave dynamics enabled a more comprehensive characterization of the ovarian function of cows with and without PL. Through a better understanding of ovarian function and the development of more effective hormonal interventions regimens, novel resynchronization programs based on the ovarian status of cows at nonpregnancy diagnosis were developed and tested. Recent work demonstrated improved reproductive performance and management outcomes. However, these novel Re-AI programs have not yet been optimized. Preventing expression of estrus due to early resynchronization and suboptimal responses to key hormonal interventions continue to limit progress. Avenues for continued improvement include novel methods to identify cows affected by PL, predict occurrence of estrus, predict the stage of the estrous cycle, determine CL function and response to PGF2α, and predict the ability of follicles to continue growing or ovulate. Major gains in reproductive performance and management outcomes might be realized by focusing research efforts on incorporating novel technologies to predict and control ovarian function and thus enable further reduction of the IBI and enhancing fertility of reinseminations."
Joint Reproduction and Physiology and Endocrinology Symposium: Physiology and Management of Previously Inseminated Cows: Approaches for Reinsemination Symposium Reproduction 2024/06/18 09:15:00 t91307 Watch 1342 In-line milk progesterone monitoring: Potential for identification of nonpregnant cows. 4 T. C. Bruinjé fertility,precision technology,reproduction T. C. Bruinjé1, S. J. LeBlanc1, D. J. Ambrose2 "In-line milk progesterone (P4) monitoring has become an increasingly available tool in Canada and Europe to support reproductive management. The in-line milk P4 analyzer (Herd Navigator, DeLaval) uses a built-in lateral flow immunoassay to measure real-time P4 to determine the onset of cyclicity, day of estrus, and pregnancy status after artificial insemination (AI). Sampling starts at 20 DIM and occurs on average every 2 d until pregnancy, with sampling frequency adjusted by a model according to the estimated stage of the estrous cycle. Sampling is more frequent between ~17 and 24 d after AI to identify return to estrus, characterized by a decline in P4 levels to below a threshold. Pregnancy alerts start ~27 d and stop ~55 d after AI in cows without a P4 decline. In a set of studies with 158,961 in-line milk P4 records from periods before and after 4,353 AI events in 1,821 lactations, we characterized predictors of pregnancy per AI and investigated P4 profiles in open cows that did not have timely return to estrus. Some of the predictors were prolonged luteal phase, suboptimal peak P4, elevated nadir P4 preceding AI, and suboptimal P4 following AI. Between 31 and 46% of cows had at least one metric of P4 profile unfavorable to pregnancy. However, these variables had low predictive abilities based on ROC cut points (AUC <0.60). Among open cows, 9%, 71%, and 20% returned to estrus ≤17, 19 to 23, or ≥25 d after AI, respectively. Among inseminated cows without a P4 decline, 14% had a false positive pregnancy alert at 30 ± 3 d after AI, and milk P4 declined ≤34, 37 to 44, or ≥48 d after AI in 22%, 59%, and 19% of those cows, respectively. Incorporating a confirmatory early pregnancy diagnosis may help determine if delayed return to estrus in 20% of cows without a pregnancy alert, or return to estrus shortly after a pregnancy alert in 14% of cows, are indications of abnormal estrous cycles or pregnancy losses. Monitoring in-line milk P4 is a valuable tool to identify predictors of pregnancy outcomes and opportunities for selective breeding decisions, as well as to identify nonpregnant cows for timely reinsemination."
Joint Reproduction and Physiology and Endocrinology Symposium: Physiology and Management of Previously Inseminated Cows: Approaches for Reinsemination Symposium Reproduction 2024/06/18 09:15:00 t91898 Watch 1343 Doppler ultrasonography versus on-farm milk progesterone (P4) for early pregnancy diagnosis: Opportunities and challenges for the development of rapid timed rebreeding programs. 5 J. P. N. Andrade Doppler,milk progesterone,dairy cow J. P. N. Andrade1, M. C. Wiltbank1 "Daily detection of estrus in cows that were previously inseminated is the earliest and most common method for detecting nonpregnant cows, allowing an immediate reinsemination of these cows and enhanced reproductive efficiency. On the other hand, Resynch strategies that prioritize timed AI (TAI) boost reproductive performance by breeding all nonpregnants ~35 d after the previous TAI with a potential increase in pregnancy/AI optimizing hormonal milieu at AI. Nevertheless, most analyses indicate similar time to pregnancy in comparisons in rebreeding programs based on estrus detection versus Resynch programs. Thus, systems for rebreeding lead to substantial variation among farms based on management priorities (labor, facilities, goals, etc.). To develop an aggressive rebreeding program, we have evaluated programs that allow early detection of nonpregnant cows and immediate TAI, to increase the number of pregnancies before 130 DIM. Early pregnancy in lactating dairy cows is associated with more milk production, greater fertility, and fewer health disorders in the next lactation. On-farm methods to assess corpus luteum (CL) functionality such as color Doppler ultrasound (CDU) and milk P4 have been used for indirect detection of nonpregnancy. While CDU has been successfully incorporated into commercial beef cattle operations, it is still an area of research for high-producing lactating dairy cows. The problems with early rebreeding programs in lactating dairy cows are related to a later (~d 21) and more variable time to luteolysis in cows that do not become pregnant to previous AI. This leads to a greater false positive rate (active CL even though nonpregnant). Preliminary results indicate several factors can affect the accuracy of CDU compared with milk P4 as early pregnancy diagnosis methods. Furthermore, there are many challenges in developing early timed rebreeding programs, optimized for high-producing lactating dairy cows, particularly methods for synchronizing the time of luteolysis, without using PGF2α."
Joint Reproduction and Physiology and Endocrinology Symposium: Physiology and Management of Previously Inseminated Cows: Approaches for Reinsemination Symposium Reproduction 2024/06/18 09:15:00 n9106 Watch   Discussion 6        
Joint Ruminant Nutrition, Physiology and Endocrinology, and Lactation Biology Symposium: Update on the Arterial-Venous Approach and Application to Current Unanswered Questions Symposium Ruminant Nutrition 2024/06/17 09:15:00 s10625                
Joint Ruminant Nutrition, Physiology and Endocrinology, and Lactation Biology Symposium: Update on the Arterial-Venous Approach and Application to Current Unanswered Questions Symposium Ruminant Nutrition 2024/06/17 09:15:00 t92136 Watch 1157 What mammary flux has taught us about amino acid and protein metabolism in dairy cows. 1 H. Lapierre uptake,milk,protein synthesis H. Lapierre1, R. Martineau1, S. Lemosquet2, G. E. Lobley3, D. R. Ouellet1 "In dairy cows, milk protein yield (MPY) is the major net user of absorbed AA, but fates of individual AA vary across the mammary gland (MG). Mammary net fluxes have been used to classify EAA transfers into MPY. The MG net uptake of Group 1 EAA (His, Met, Phe+Tyr, Trp) is approximately equal to MPY, whereas net uptake of Group 2 EAA (Ile, Leu, Val, Lys) exceeds MPY, with the excess being variable. This reflects the site of EAA catabolism, from liver catabolism (Group 1) to oxidation in peripheral tissues, including MG (Group 2). For example, post-liver supplies of Lys and Met averaged 97 and 66% of their net portal absorption, whereas their MG uptake:output ratios (U:O) averaged, respectively, 1.15 and 0.98, indicating extensive Lys MG catabolism (n = 43, 14 studies). Mammary uptake of EAA can also increase with additional energy supply, but the U:O of Group 1 EAA is maintained at unity whereas the U:O of Group 2 EAA decreases, yet remains above unity. Increased MPY can be supported by greater arterio-venous difference (increased EAA supply) or by increased blood flow to the MG (extra energy provision). In contrast, for most NEAA, except for Ala, Gln, and Tyr, the U:O is usually less than 0.75, indicating important NEAA MG synthesis to support the MPY. To understand the dynamic mechanisms involved requires use of nutrients labeled with stable isotopes. For example, 13C-Leu used for MG protein synthesis (PS) averages 40% of whole body (WB) PS, with approximately 75% of this PS appearing as MPY. The excess of Leu taken up is oxidized within the MG, and contributes 40 to 50% of WB Leu oxidation. There is no mammary oxidation of Phe. The 15N of Lys taken up in excess of MPY is transferred to various NEAA: these products contribute to PS, including MPY, or are released into MG venous blood. Overall, the MG demand drives much of EAA metabolism but is very flexible and can switch between substrates to maintain MPY. What are the limitations to such flexibility? Resolution would require more studies combining measurements of MG fluxes using isotopes and of expression of genes related to AA metabolism and PS."
Joint Ruminant Nutrition, Physiology and Endocrinology, and Lactation Biology Symposium: Update on the Arterial-Venous Approach and Application to Current Unanswered Questions Symposium Ruminant Nutrition 2024/06/17 09:15:00 t92201 Watch 1158 ADSA-EAAP Speaker Exchange Presentation: What have measurements of splanchnic flux taught us about ruminant gastrointestinal physiology? 2 C. K. Reynolds absorption,metabolism,flux C. K. Reynolds1, L. A. Crompton1, M. Larsen2 "There is a long history of research using measurements of venous-arterial concentration differences (VA) to describe ruminant splanchnic (portal-drained viscera [PDV] and liver) physiology and metabolism, from pioneering research with anaesthetized sheep, to long-term studies with high-yielding dairy cows. High rates of metabolism of PDV (gastrointestinal tract [GIT], spleen, pancreas, and associated adipose) and liver tissues are mirrored by high blood flow and O2 consumption and thus substantial impacts on diet energy use. Measurements have quantified amounts of nutrients absorbed and available for productive purposes, as well as challenging dogma, in some cases regarding interpretation of results. The VA alone tell little about rates of metabolism unless coupled with blood flow to calculate flux; however, net flux reflects combined rates of a metabolite’s uptake and release. Greater insight is gained when VA and blood flow are coupled with isotopic labeling to measure unidirectional flux, which has challenged the concept of substantial “first-pass” absorptive metabolism of acetate, glucose, and individual amino acids (AA). Changes in liver uptake of AA relative to glucose release in early lactation has also challenged the dogma of essential AA being required to meet glucose demands of high milk yields, as only alanine, with lactate, have greater relative contributions to glucose precursor supply. The integration of splanchnic and mammary gland fluxes is a powerful approach. Linking splanchnic flux with digestion and body energy and N balance, through mathematical models, also provides invaluable insights and a framework for revisions to nutrient requirement systems. Splanchnic tissues are a rich source of regulatory peptides, with neural connections integrating metabolism of the GIT, pancreas, liver, and other body tissues. Future studies should consider less invasive surgical procedures, as well as novel analytical approaches for measuring blood components and regulatory peptides integrating nutrient metabolism of the splanchnic tissues with requirements for production and maintenance."
Joint Ruminant Nutrition, Physiology and Endocrinology, and Lactation Biology Symposium: Update on the Arterial-Venous Approach and Application to Current Unanswered Questions Symposium Ruminant Nutrition 2024/06/17 09:15:00 t91598 Watch 1159 Modeling arteriovenous difference data: Benefits and opportunities. 3 M. D. Hanigan arteriovenous difference,model,isotope M. D. Hanigan1 "For tissues with discrete arterial or venous blood supplies, the arterio-venous (AV) difference technique can be used to assess mass balance of individual metabolites across the tissue. When combined with mass balance data from the animal, one can determine the fraction of a nutrient supplied by the diet that is utilized by the tissue. When combined with observations from other tissues, a picture of metabolite flow through the post-absorptive system under varying circumstances can be assembled. However, AV is a net difference observation, and it does not provide unidirectional information for fluxes that have bi-directional flows, nor does it directly identify the pathways used to metabolize the metabolite. If one combines the technique with stoichiometry-based, mass balance models, the set of balanced equations greatly constrains the solution space allowing derivation of net flux rates for a range of pathways. Selective use of isotopic tracers with steady-state or nonsteady-state sampling allows the identification of additional pathway fluxes, and, if collected over time, bi-directional fluxes often can be parsed into unidirectional rates. Where the isotope is infused until steady-state, the models can often be solved algebraically. More complicated models or those applied to nonsteady-state conditions can be solved numerically. The functional flux data derived from these efforts can be combined with molecular observations of gene expression, RNA translation, post-translational modifications, and systemic observations of physiological, hormonal, and neural states to generate a complete picture of tissue metabolism and regulation under a range of feeding and management conditions. Challenges that must be weighed against the power of these approaches include surgical preparation of the animals, the need to sample over time to minimize temporal variation, the cost of labor to conduct the animal experiments, and the large number of samples generated, particularly when utilizing nonsteady-state isotope methods."
Joint Ruminant Nutrition, Physiology and Endocrinology, and Lactation Biology Symposium: Update on the Arterial-Venous Approach and Application to Current Unanswered Questions Symposium Ruminant Nutrition 2024/06/17 09:15:00 t91905 Watch 1160 Opportunities for understanding energy and protein efficiencies of dairy cows using arteriovenous difference methodology. 4 J. P. Cant mammary glands,arteriovenous differences,lactation J. P. Cant1, A. J. Fischer-Tlustos1, K. Nichols2 "The efficiency of capture of digestible energy and protein in milk depends on their partitioning between milk components, body components, and catabolism. Alternatively, one can view partitioning of nutrients between the main organs of gut, liver, mammary glands, adipose, and muscle/remainder. Within each organ, the input-output relationships obtained from arteriovenous difference measurements can be used to formulate the same maintenance/production model of nutrient utilization that is commonly applied to the whole animal. We use data from the mammary glands to illustrate how the 2 levels of organization—organ and whole animal—are reconcilable, to point out how efficiency of energy retention is an outcome of laws of thermodynamics whereas efficiency of amino acid retention is not, and to highlight some potential areas of interest needing further exploration, such as mammary nutrient utilization during the dry period and at calving, tissue retention of protein and fat, uptake of long-chain fatty acids, and non-invasive blood flow measurement."
Joint Ruminant Nutrition, Physiology and Endocrinology, and Lactation Biology Symposium: Update on the Arterial-Venous Approach and Application to Current Unanswered Questions Symposium Ruminant Nutrition 2024/06/17 09:15:00 n9117 Watch   Discussion 5        
Production, Management, and the Environment Symposium: Revisiting Progress in Feed Efficiency: Its Role in Advancing Dairy Sustainability Symposium Production‚ Management‚ and the Environment 2024/06/17 09:15:00 s10624                
Production, Management, and the Environment Symposium: Revisiting Progress in Feed Efficiency: Its Role in Advancing Dairy Sustainability Symposium Production‚ Management‚ and the Environment 2024/06/17 09:15:00 t91952 Watch 1153 Phenotypic and genomic relationships between energy efficiency and protein efficiency among dairy cows. 1 M. J. VandeHaar efficiency,genetics,nutrition M. J. VandeHaar1, E. Liu1 "Feed efficiency is a function of level of production, differences in digestion and metabolism among cows, diet composition, and management. As dairy cows produce more milk on the same diet, milk energy per unit feed energy and milk protein per unit feed protein also increase because feed needs for maintenance are diluted by feed needs for production. Within a level of production, some cows use feed more efficiently than others; they need less feed than expected and have a negative residual feed intake (RFI). We recently showed that cows with negative RFI also use protein more efficiently. In animal breeding, both level of production and RFI are used in genetic selection, and selecting for energy efficiency will increase protein efficiency. In animal feeding, however, to maximize energy efficiency, dietary protein must not be limiting, and to maximize protein efficiency, no protein fraction should be in excess and instead metabolizable protein must be limiting. When cows are fed excess energy, they store the excess, but when cows are fed excess protein, they waste the excess, and this waste decreases not only protein efficiency but also energy efficiency. In the future, to improve dairy sustainability, we should continue to select for feed efficiency in breeding programs, feed to maximize milk production and health, and continue to refine protein requirements. We should also feed cows according to their needs by grouping or computerized supplementation and perhaps select cows that have lower protein requirements. By selecting for greater feed efficiency and production, methane emissions per unit milk will continue to decrease, although not dramatically. However, even if feed additives cause dramatic reductions in methane, cows will continue to produce methane. One justification for a continued thriving dairy sector is that cows can convert ecological leftovers into high-quality food for humans, and thus increase net food production and sustainability. The earth can feed more people with a thriving and efficient dairy sector than without one. We should do more to communicate this positive message to consumers."
Production, Management, and the Environment Symposium: Revisiting Progress in Feed Efficiency: Its Role in Advancing Dairy Sustainability Symposium Production‚ Management‚ and the Environment 2024/06/17 09:15:00 t92141 Watch 1154 The Resilient Dairy Genome Project synthesis—Overview of feed efficiency and methane emissions. 2 C. Baes genomics,methane,feed efficiency C. Baes1,2, D. Hailemariam3, G. Kistemaker4, F. Miglior1,4, F. Schenkel1, A. Butty5, E. Abdala6, J. Lassen7, O. Gonzáles-Recio8, K. Parker-Gaddis9, J. Koltes10, F. Peñagaricano11, M. VandeHaar12, K. Weigel11, H. White11 "The demand for dairy products is increasing; however, the dairy industry is under growing scrutiny with regard to potential issues related to human and animal health, environmental impacts, sustainability, and overall social acceptability. The Resilient Dairy Genome Project (RDGP) is a significant international effort involving researcher and industry partners. The primary objective of the RDGP is to leverage genomic techniques to bolster the resilience of dairy cattle. To achieve this goal, the project focuses on collecting and analyzing phenotypic data in key areas such as fertility, disease resistance, and environmental efficiency. Within this project, resilience is defined as the capacity of an animal to adapt rapidly to changing environmental conditions, without compromising its productivity, health or fertility, while becoming more resource-efficient and reducing its environmental burden. The collection and analysis of phenotypes in the key areas of “closer-to-biology” fertility (e.g., estrous expression and embryo survival), enhanced disease resistance (e.g., fertility disorders, Johne’s disease, leukosis, and calf health), and environmental efficiency (e.g., feed efficiency and methane emissions) contribute to this definition of resilience. Here we present a synthesis of this large-scale project, including an overview of various analyses involving interactions between genes and environment in the context of dairy cattle resiliency."
Production, Management, and the Environment Symposium: Revisiting Progress in Feed Efficiency: Its Role in Advancing Dairy Sustainability Symposium Production‚ Management‚ and the Environment 2024/06/17 09:15:00 t91176 Watch 1155 Interplay of rumen microbiome and host modulating feed efficiency and carbon emission in cattle. 3 T. A. McAllister efficiency,microbiome,systems T. A. McAllister1,2, R. J. Gruninger1, S. A. Terry1, L. L. Guan2 "As the majority of energy and protein supplied to cattle arises as a result of ruminal fermentation, the rumen microbiome plays an integral role in determining host feed efficiency. Counterintuitively, current evidence suggests that a less diverse rumen microbiome is associated with improved feed efficiency, possibly as a result of greater metabolic precision and avoidance of energy spilling fermentative pathways. The composition of the rumen microbiome is mainly determined by diet, but host traits such as rumen volume, rate of passage, rumination, and immunity also have influence. Although less microbial diversity may improve feed efficiency in cattle fed a specific diet, reduced diversity may impair the ability of cattle to adapt to frequent changes in diet and the environment. Hydrogen exchange and capture is the energetic foundation of the rumen microbiome, and considerable capital has been invested to develop additives that redirect hydrogen flow away from the reduction of CO2 to CH4 and toward alternative sinks. These additives have been shown to reduce enteric CH4 emissions by 30–80%, but improvements in feed efficiency have been less than the stoichiometric predictions. Approaches to improve the feed efficiency of cattle need to be multifaceted with consideration for host genetics, functional efficiency of the rumen microbiome, and the structure and composition of feed. Likewise, reductions in carbon emissions need to be broader than just CH4, with an appreciation of how cattle can play a role within a circular bioeconomy to promote upcycling of nutrients and reductions in emissions from a farming systems perspective. Strategies to improve the efficiency of cattle production are a prerequisite for the sustainable intensification needed to ensure that the social license for milk and meat production from cattle is retained."
Production, Management, and the Environment Symposium: Revisiting Progress in Feed Efficiency: Its Role in Advancing Dairy Sustainability Symposium Production‚ Management‚ and the Environment 2024/06/17 09:15:00 t91675 Watch 1156 The role of production systems in feed efficiency and carbon emissions. 4 A. F. Brito feed efficiency,methane,sustainability A. F. Brito1 "Evaluation of feed efficiency (calculated as ECM yield/DMI) and milk N efficiency (calculated as milk N yield/N intake) is needed to help dairy producers making decisions about the economic and environmental sustainability of their farms. It is well known that feed efficiency and milk N efficiency are both affected by production level and management practices, with high-output confinement systems yielding better efficiency metrics compared with their pasture-based counterparts. Furthermore, CH4 yield (g/kg of DMI) and CH4 intensity (g/kg of ECM) generally decrease in dairy cows fed TMR compared with pasture despite these responses being heavily influenced by the type of the grazing system and pasture nutritive value. Note that pasture-based systems perform multiple ecosystem services including carbon sequestration and improved biodiversity, which is not routinely quantified in typical life cycle analyses (LCA). The overarching objective of this symposium paper is to present results of feed efficiency, milk N efficiency, and enteric CH4 emissions of dairy cows under different production systems (i.e., confinement, pasture-based, mixed). A second objective is to present whole-farm greenhouse gas emissions data from LCA studies published in the literature, highlighting the range in carbon footprint across various production and management systems. Specifically, greenhouse gas emissions and climate change mitigation potential of emerging production systems such as organic grass-fed dairy and silvopasture will be assessed. Factors including farm size, herd size, region, and animal breed relative to efficiency and carbon emissions will be covered as well."
Reproduction Symposium: Improving Pregnancy Survival in Dairy Cows: Challenges and Opportunities Symposium Reproduction 2024/06/19 13:30:00 s10747                
Reproduction Symposium: Improving Pregnancy Survival in Dairy Cows: Challenges and Opportunities Symposium Reproduction 2024/06/19 13:30:00 t91916 Watch 1619 The dichotomy between pregnancy survival and loss: Challenging “post”-conceived notions. 2 M. C. Wiltbank pregnancy,progesterone,interferon-tau M. C. Wiltbank1, J. P. Andrade1, V. Gomez-Leon2, A. Garcia-Guerra3, P. L. J. Monteiro1,4, R. R. Domingues3, P. M. Fricke1, R. Sartori5 "Pregnancy loss is a prevalent and expensive problem in lactating dairy cows and in recipients of in vitro produced (IVF) embryos. Unfortunately, the causative etiology, outside of health and environmental challenges, and consistent methods to predict and prevent pregnancy loss still mostly elude reproductive physiologists. Previous research reported ~50% of embryos were degenerate by d 7 after AI. In contrast, 2 recent studies that used the DoubleOvsynch protocol reported >80% high-quality embryos on d 7 (85.1%) suggesting early embryonic problems can be reduced by preovulatory environment. This talk will focus on recent results using early pregnancy diagnosis by measurement of interferon-stimulated genes (ISGs) in cervical epithelial cells and circulating pregnancy-associated glycoproteins (PAGs). Based on ISGs on d 17 after AI, P/AI in lactating dairy cows is over 80% (81.4%) with only 12.8% loss during the interferon-tau (IFNT) period (d 17–22). Nonetheless, soon after embryonic attachment (initial PAG increase) is the greatest period of pregnancy loss (d 22–32) in both lactating cows (24.6%) and heifer recipients of IVF embryos (25.0%). From d 32 to d 62, there is another 9–12% pregnancy loss. In one study the pregnancy loss was reduced in lactating cows by producing a new accessory corpus luteum (CL) by GnRH treatment on d 5 but only if the new accessory CL was ipsilateral to the pregnancy. In heifers, treatment with intravaginal P4 has been successful in decreasing pregnancy loss in some, but not all, experiments apparently by improving P/ET in embryos with suboptimal placentation, based on PAGs. Recent experiments indicate that about half of pregnancy losses are initiated by CL regression in the presence of a functional embryo. Our initial results indicate that these potential pregnancy losses can be avoided by providing elevated P4 from an intravaginal implant and inducing a new accessory CL to maintain the pregnancy. Thus, these results offer optimism that an understanding of the underlying causes of pregnancy loss can allow development of physiologically-rational methods for overcoming this reproductive problem."
Reproduction Symposium: Improving Pregnancy Survival in Dairy Cows: Challenges and Opportunities Symposium Reproduction 2024/06/19 13:30:00 t91521 Watch 1620 Developing and testing a novel model for conceptus attachment to gain a greater understanding of pregnancy loss in lactating dairy cows. 3 J. R. Pursley conceptus attachment,dairy cow,fertility J. R. Pursley1, A. Santos1, T. Minela1 "Reducing pregnancy losses is critical for ensuring longevity of dairy cows. This presentation will outline the creation of an innovative approach to assess the timing of conceptus attachment and discuss recent breakthroughs in identifying factors influencing this crucial stage of pregnancy. Serum samples collected daily from d 17 to 28 post-AI were used to detect the onset of pregnancy-specific protein B. Initial studies indicated that nulliparous heifers had earlier conceptus attachment compared with lactating cows and primiparous cows had earlier conceptus attachment compared with multiparous cows. Most cows have conceptus attachment on d 20 or 21 post-AI. Thus far, all studies agree that cows with conceptus attachment >21 d post-AI have greater chances for pregnancy loss compared with cows that have earlier conceptus attachment. Treating multiparous cows post-AI with human chorionic gonadotropin to increase progesterone during elongation reduced the percentage of cows with conceptus attachment and prolonged time to attachment. Serum concentrations of PSPB were consistently reduced following conceptus attachment in cows with pregnancy loss compared with cows that maintained pregnancy. This model has enhanced our understanding of the fertility potential of AI following estrus when compared with Double Ovsynch as the gold standard for dairy cow fertility. Cows that received AI, and ovulated, following estrus had decreased chances for conceptus attachment compared with Double Ovsynch. Timing of AI related to the onset of estrus determined with automated activity monitoring did not affect outcomes. Cows with a previous estrus had greater chances for conceptus attachment compared with cows without a previous estrus. Cows treated with Double Ovsynch benefitted from at least 2 previously detected estruses with an increase of ≥30% in percent of cows with conceptus attachment. This paper will discuss how gaining a greater understanding of conceptus attachment may lead to new manipulative approaches to increase fertility and longevity of lactating dairy cows."
Reproduction Symposium: Improving Pregnancy Survival in Dairy Cows: Challenges and Opportunities Symposium Reproduction 2024/06/19 13:30:00 t91432 Watch 1621 Pregnancy loss in embryo transfer recipients: Risk factors and mitigation strategies. 4 P. Baruselli embryo transfer,reproductive efficiency,biotechnology P. Baruselli1, B. Catussi1, E. Gricio1, M. Viziack1, L. Factor1, C. Rodrigues2 "Early embryo development, implantation and pregnancy involve a complex dialog between the embryo and mother. Our research group studied the risk factors that affect pregnancy loss (PL) in Holstein cows that received embryos. During heat stress (HS), the overall conception rate (CR) decreased for Holstein cows submitted to either AI or ET (season effect). However, CR was always higher following ET compared with AI (breeding technique effect), especially during HS (interaction season × breeding technique). Moreover, PL was higher during HS than in the cooler season and for ET than for AI, with no interaction season × breeding technique. Despite greater PL, cows receiving ET had higher pregnancy rates (PR) after 60 d than AI. The embryo grade quality was linearly associated with PR. As the quality of the grade decreased, the PR per ET also decreased. However, the PL only tended (P = 0.07) to be influenced by embryo quality with the smallest loss for recipients receiving an embryo graded as 1 compared with grades 2 to 3. Lactating Holstein cows that received AI, in vivo ET and in vitro ET were studied to analyze gestational outcomes: gestation loss, abortion, and birth rates. ET showed higher PR, with similar PL when compared with AI. Additionally, in vivo ET showed similar PR and PL than in vitro ET. Comparing abortion rates (60 d to calving), pregnancies from in vivo ET had a higher rate (26.8%) than AI (23.5%), whereas in vitro ET (26.4%) had no difference. Holstein cows pregnant with in vivo ET had a lower birth rate of 66.1% compared with AI at 70.8%. However, in vitro ET (67.5%) did not differ significantly from in vivo ET or AI. We conducted a study to analyze the reproductive performance of lactating Holstein cows (milk yield 33.0 L) and crossbred beef cows (cross Bos indicus) after they received a Holstein in vitro ET. The birth rate was higher for beef recipients (83.1%) than for lactating milk recipients (67.5%). To summarize, the incidence of PL is higher in ET than in AI. Various factors such as HS, embryonic quality, embryo production (in vivo or in vitro) and the recipient can impact PL."
Reproduction Symposium: Improving Pregnancy Survival in Dairy Cows: Challenges and Opportunities Symposium Reproduction 2024/06/19 13:30:00 n9099 Watch   Panel Discussion 5        
Ruminant Nutrition Symposium: Advances in Analytical Procedures Affecting Dairy Nutritionists Symposium Ruminant Nutrition 2024/06/19 13:30:00 s10745                
Ruminant Nutrition Symposium: Advances in Analytical Procedures Affecting Dairy Nutritionists Symposium Ruminant Nutrition 2024/06/19 13:30:00 t92210 Watch 1634 Forage and feed laboratory focus to support industry advancement. 1 R. Ward forage analysis feed analysis,NIR,laboratory methods R. Ward1 "Forage and feed characterization underlies the ability to monitor nutrient variation at the farm, provide inputs for ration modeling, understand nutritional contribution to cow response, and execute animal and agronomic research. While different applications of data have different underlying requirements, data users all benefit from standardization and definition of methods by which data are produced and reported. Forage laboratories in the US over the last 40 years have provided huge competitive advantage to the feed industry through fast execution of analysis at very affordable prices. Quality of execution has improved significantly over this time. To support the needs of technology development and AI applications, defined method protocols, sampling variation, lab variation, and sample relationship to population data become more important considerations. This underlying information supporting the generated lab data should be readily available to the user of the data. Systems required to improve lab performance and support provision of a significant amount of additional information require investment by labs that the industry must be willing to support. In this talk we will consider (1) current status of defining lab methods, (2) defining primary method lab methods for applicability, precision and accuracy, (3) a brief discussion of sampling theory and sample presentation for given assay needs, (4) consideration of the sensitivity of the assay, (5) qualification of NIR equation models and predictions, (6) reporting and data access considerations, (7) cooperative relationships with private and academic institutions to develop new methodologies, and (8) current investigations of technologies to improve feedstuff characterization."
Ruminant Nutrition Symposium: Advances in Analytical Procedures Affecting Dairy Nutritionists Symposium Ruminant Nutrition 2024/06/19 13:30:00 t92006 Watch 1635 Reliability of near-infrared reflectance spectroscopy (NIRS) to accurately predict nutrient composition of forage and feed ingredients. 2 D. W. McIntosh forage,feed,NIRS D. W. McIntosh1, B. J. Husmoen2, E. A. Eckelkamp1, P. Berzaghi3, G. E. Bates1 "Forage and feed ingredients contain valuable nutritive content information that often-expensive wet chemistry testing is not conducted, or the distrust in near infrared spectroscopy (NIRS) predictions hinder the researcher or producer submitting samples to laboratories for analysis. Overcoming this hurdle is a must to understand the accuracy and reliability of NIRS. With an overwhelming reminder that calibrations have improved immensely while being developed with accuracy and the validation necessary to change this. Identification of best practices from sampling, identification, particle size, and dry matter at scanning all affect the final analyte data in both the primary (wet chemistry) and secondary method NIRS. Additionally, reporting these data correctly and validating for scientific journal publication is becoming increasingly important. To enhance trust with researchers, nutritionists, and producers, laboratories are encouraged to communicate more fully and openly about the procedures used to generate accurate NIRS predictions. This discussion will provide an in-depth identification of an ideal dry matter (DM) range when scanning samples with essential techniques implemented across laboratories. Techniques for presentation of samples to instrumentation should be appropriate to achieve the best possible prediction, whether a one-time sample or an entire project. The impact of this is significant along with the other factors affecting NIRS predictions in bench-top or portable instrumentation. Improving results for research and provided to laboratory clientele will be discussed with specific examples for across laboratory comparison, calculations using analyte predictions, and proper validation techniques."
Ruminant Nutrition Symposium: Advances in Analytical Procedures Affecting Dairy Nutritionists Symposium Ruminant Nutrition 2024/06/19 13:30:00 t91287 Watch 1636 Impact of alternative methods on measurement of NDF compared to the official method. 3 M. B. Hall fiber,feed analysis,methods M. B. Hall1 "Neutral detergent fiber (NDF) is an important metric of fiber in dairy cattle nutrition that is used in diet formulation and feed valuation. An empirical method, NDF is defined by the procedure used to measure it. AOAC Official Method 2002.04 (AOAC) is the current definitive method for NDF treated with amylase (aNDF). It is performed on dried samples ground through the 1-mm screen of a cutting mill with refluxing and then filtration through coarse porosity Gooch crucibles without or with a filtration aid. Method variants with modifications such as grinding materials through the 1-mm screen of an abrasion mill or using different filtration or extraction systems must give analytical values equivalent to AOAC or they do not measure aNDF. Comparisons must rigorously adhere to recommended procedures. Extraction of samples and recovery of the residue on filters may be affected by method variants. Grinding though a 1-mm screen with an abrasion mill versus a cutting mill gives a finer particle size, possibly allowing greater extraction or escape. Extracted particles may pass through filters when liquid carrying the particles flows through; this is affected by a filter’s particle retention value (PR). Performance of filters and filtration methods must be assessed within the procedure used. Simultaneous extraction and filtration used in filter bag systems gives particles the time of extraction and rinsing to interact with the filter, whereas decanting, rinsing, and soaks give less time in other filtration systems. In a limited study, filter bags gave values closer to AOAC when bags with finer PR were used. Crucibles that are plugged or degraded can also deviate from AOAC. In a limited study, best agreement between AOAC and aNDF method variants was achieved with the 1-mm screen cutting mill grind. The 1-mm abrasion mill grind produced more aNDF% results that were lower than AOAC but with fewer differences when filter PR was smaller. The use of filters that retain finer particles could be explored to improve comparability of NDF method variants and grinds with AOAC. Further evaluation with an expanded set of materials is needed."
Ruminant Nutrition Symposium: Advances in Analytical Procedures Affecting Dairy Nutritionists Symposium Ruminant Nutrition 2024/06/19 13:30:00 t91511 Watch 1637 Impact of laboratory feed digestibility methods on nutrition models. 4 M. Van Amburgh digestibility,modeling,feeds M. Van Amburgh1, A. LaPierre1 "Accurate predictions of nutrient flows in formulation models rely on a comprehensive description of all ingredients within a diet. To best describe this behavior requires a series of chemical and enzymatic assays to estimate characteristics, including solubility and insolubility, ruminal digestibility, rates of degradation, and intestinal digestibility. When characterizing carbohydrate digestibility, the detergent chemistry methods of Van Soest and Mertens serve as the foundation for most models, describing fiber and cell soluble fractions for most cellulosic-based feeds. These fractions behave uniformly when analyzed chemically; however, several methods exist to assess fiber degradability, each leading to different interpretations of an ingredient’s digestibility. A time series analysis to measure fiber disappearance is equally imperative, as pools of potentially degradable fiber can be fractionated into different pools, each with its rates of degradability. The use of these fractions has improved predictions in energy supply, microbial yield, DMI, and the role of particle size in rumen fill. Laboratory analyses for sugar, starch, and soluble fiber also exist and are routinely performed, yet the interpretability and use of these data can be biased based on the allocation of results and the user-preferred modeling approach. The correct appropriation of nutrients into digestible fractions becomes important because although the predicted total-tract digestibility for the sum of sugars and soluble fiber are different, the location of degradation, either ruminally or postruminally, will alter the predicted microbial supply and alter rumen outflow of protein. The measurement of the digestibility of sugar and soluble fiber are not routinely conducted due to lower uniformity of recovery. Finally, methods for intestinal protein digestibility are important and independent of the estimation of RUP. Acid detergent insoluble protein has been a relevant measure of undigestible protein in forages and requires no estimation of RUP. Similar approaches are needed for non-cellulosic, proteinaceous feeds for ruminants and should be independent of any estimation of RUP."
Ruminant Nutrition Symposium: Advances in Analytical Procedures Affecting Dairy Nutritionists Symposium Ruminant Nutrition 2024/06/19 13:30:00 n9113 Watch   Panel Discussion: Improving collaboration between academia and industry in labs 5 Nicole Schlau      
Ruminant Nutrition Symposium: Functional Nutrients Symposium Ruminant Nutrition 2024/06/18 09:15:00 s10689                
Ruminant Nutrition Symposium: Functional Nutrients Symposium Ruminant Nutrition 2024/06/18 09:15:00 t91793 Watch 1356 Fatty acids as bioactive nutrients in lactating dairy cows. 1 A. L. Lock milk fat,nutrient partitioning,adipose tissue A. L. Lock1, G. A. Contreras1 "Our understanding of fatty acid (FA) digestion and metabolism in dairy cows has advanced significantly in the last few decades. We increasingly recognize that FA, both of dietary and rumen origin, can have different and specific effects on feed intake, rumen metabolism, small intestine digestibility, milk component synthesis in the mammary gland, energy partitioning between the mammary gland and other tissues, and inflammation. We will present recent research focusing on specific FA and how dairy cows respond differently to combinations of FA. Palmitic (C16:0), stearic (C18:0), and oleic (cis-9 C18:1) acids usually comprise the majority of FA present in milk fat and adipose tissue of dairy cows. While these FA have different functions in metabolism, they may also interact with each other by competitive or complementary mechanisms under different physiological conditions. In the mammary gland, lipid synthesis is dependent upon the simultaneous supply of short/medium-chain FA and long-chain FA. C16:0 has a higher preference as a substrate to start triglyceride synthesis than C18:0 or cis-9 C18:1. Also, if the amount of preformed FA surpasses the capacity of the mammary gland, these might be redirected to other tissues (e.g. adipose tissue) altering energy partitioning. In periparturient cows, cis-9 C18:1 limits lipolysis, improves adipose tissue insulin sensitivity, and may enhance mitochondrial biogenesis and function, which will minimize body weight loss and maximize lactation performance. Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are the most bioactive FA in the omega-3 family, with known anti-inflammatory effects. Recent data demonstrate that DHA supplementation can increase the concentrations of DHA-derived anti-inflammatory and pro-resolving oxylipins with the potential to limit inflammatory responses driven by metabolic challenges. Research will undoubtedly continue to improve our understanding of the bioactive roles of FA rather than FA simply being considered as fuels and building blocks. The challenge and opportunity will be to effectively apply this knowledge in the feeding and management of today’s high-producing dairy cows."
Ruminant Nutrition Symposium: Functional Nutrients Symposium Ruminant Nutrition 2024/06/18 09:15:00 t90991 Watch 1357 The impact of fatty acids as bioactive nutrients on the development of offspring. 2 A. Relling DNA,n-3,programming A. Relling1 "Fatty acids (FA) are normally considered a source of energy; however, they are essential nutrients that can bind to membrane and nuclear receptors, modifying cell function and the expression of some transcripts. These effects will depend on the FA type and family FA (i.e., n-6 vs. n-3). The FA effect on developmental programs has been studied in cattle and sheep with some similitudes in the outcomes. Feeding n-3 FA during late gestation almost always improves offspring production performance (i.e., milk yield in dairy cows, growth in beef and sheep) compared with the offspring of dams supplemented with mono- and unsaturated FA or with offspring of dams with no FA supplementation. Opposite results were observed when n-3 FA were supplemented in late gestation in summer. Also, there is a sexual dimorphism in the outcomes of n-3 FA supplementation, where males have greater growth than females. Offspring born from an n-3 FA supplemented dam in early gestation had slower growth than the ones born from monounsaturated FA supplementation. No differences were observed when the FA supplementation was conducted in mid-gestation. There are multiple assumptions on how this physiological process occurs. The first unanswered question is if it is a direct effect of the FA on the fetus, if it is an effect of the FA manipulating nutrients’ placenta passage, or both. The second unanswered question is which tissue is modified during developmental programming responsible for the changes in offsprings’ growth. Research has demonstrated that the developmental effect is not due to changes in hypothalamic regulations of dry matter intake and energy expenditure or liver and adipose tissue functions. The changes in offspring growth can be attributed to changes in the gastrointestinal tract and the immune response. Feeding n-3 FA in late gestation to the pregnant dam increases the amino acid transporter expression (mRNA and protein) in the duodenum, changes associated with changes in DNA methylation. Regarding the immune function, the increase in offspring performance has been associated with decreased haptoglobin after weaning in calves or increases in Resolvin-D3 after lambing."
Ruminant Nutrition Symposium: Functional Nutrients Symposium Ruminant Nutrition 2024/06/18 09:15:00 t92208 Watch 1359 A case to be made for choline as a required nutrient for transition dairy cows. 4 J. E. P. Santos choline,dairy cow,required nutrient J. E. P. Santos1, U. Arshad1, M. G. Zenobi1, J. M. Bollatti1 "The discovery of choline dates back to 1850s when French pharmacist, Théodore Gobley discovered a group of phospholipids that he named lecithin. Seventy years later, during the discovery of insulin by Frederick Banting, his student Charles Best noticed that depancreatized dogs developed hepatic lipidosis. Subsequently in the early 1930s, Best showed that supplementing lecithin reversed and prevented hepatic lipidosis in dogs and rats. It took another 67 years for dietary choline to be acknowledged as essential in human diets. Requirements have been established for several farm animal species; however, the specific amounts of dietary choline to be fed to dairy cows have not been established. The development of rumen-protected choline (RPC) products has allowed extensive research to investigate the effects on dairy cows, in particular during the transition period. Dairy cows during transition accumulate lipid droplets into the hepatic tissue, which results in approximately 40% to 50% of them having hepatic triacylglycerol >5% in the first 2 to 3 weeks postpartum. Cows with hepatic lipidosis have increased risk of peripartum diseases. Experimental models using feed-restricted late-pregnant cows have unequivocally shown that supplementing RPC reduces the content of triacylglycerol in the liver. The mechanisms that support reduced hepatic lipidosis by RPC in feed-restricted cows are not completely understood, but involve enhanced export of triacylglycerol as nascent lipoproteins. Other mechanisms that facilitate the disposal of fatty acids from hepatocytes have been proposed and include increased cellular autophagy and lipophagy, and reduced endoplasmic reticulum stress response and hepatocyte inflammation. The effects of RPC on hepatic lipidosis are less clear in early postpartum cows, but extensive research shows an increase in production performance with some indication of benefits to peripartum health. Interestingly, the production response to supplementing RPC during the transition period extends well beyond the period of supplementation, thus suggesting effects on mammary cell metabolism that requires further investigation."
Ruminant Nutrition Symposium: Functional Nutrients Symposium Ruminant Nutrition 2024/06/18 09:15:00 n9115 Watch   Discussion 5        
Ruminant Nutrition Symposium: Integrating Statistics, Nutrition, and Economics—Recognizing the Contributions of ADSA Past President and Life Member Dr. Normand St-Pierre Symposium Ruminant Nutrition 2024/06/17 13:30:00 s10631                
Ruminant Nutrition Symposium: Integrating Statistics, Nutrition, and Economics—Recognizing the Contributions of ADSA Past President and Life Member Dr. Normand St-Pierre Symposium Ruminant Nutrition 2024/06/17 13:30:00 t92049 Watch 1248 Connecting nutrition and statistics. 1 J. L. Firkins mixed model meta-analysis,nutrient value of feeds,statistical analysis J. L. Firkins1 "Dr. Normand R. St-Pierre developed his quantitative expertise during his PhD research with Dr. Harvey (statistician) and Dr. Conrad (dairy nutritionist) at The Ohio State University. Combining statistics and economics with dairy nutrition became a unique niche and expertise often sought by others. St-Pierre was focusing on how to improve statistics for on-farm nutrition trials in 1998, which culminated in his contribution to a 2016 paper by Bello et al. that is widely referenced today. Novel and improved software (Sesame) to estimate the economic value of feeds based on their nutrients has been used for years for lay outlets. Using all of the progression of thought and statistical processes used for a 1999 meta-analysis (Oldick et al.), St-Pierre published the archetype approach for mixed model meta-analyses in our field in his 2001 landmark paper. Although cited over 600 times so far, primarily to cite the random effect of study, arguably the best parts include weighting for variance, verifying lack of interaction with study, and combining class and continuous responses while minimizing overparameterization of a model. In 2003, St-Pierre extended this expertise to proper residuals evaluation of the NRC (2001) microbial N prediction equation. Further description and refinement of meta-analyses were included in his coauthored paper with Dr. Sauvant in 2008. St-Pierre finalized model evaluation approaches in 2015 (in a coauthored paper with Boerman et al.). Over the years, St-Pierre worked with many colleagues to improve screening of databases, properly assess random blocks and experimental units, and account for collinearity and inflation of variance when using predictions as observations. His papers demonstrated the value of composite experimental designs, consideration for Type II error, use of contrasts, and multiple regression. He always reflected on properly assessing biases and distribution of error when analyzing models, in the same way that nutritionists might analyze crude protein in feeds before explaining an experimental outcome. Normand St-Pierre’s contributions to dairy science will be remembered for years to come."
Ruminant Nutrition Symposium: Integrating Statistics, Nutrition, and Economics—Recognizing the Contributions of ADSA Past President and Life Member Dr. Normand St-Pierre Symposium Ruminant Nutrition 2024/06/17 13:30:00 t91635 Watch 1249 Integrating quantitative data analyses: Application to the dairy sciences. 2 R. J. Tempelman mixed models,cross-validation,meta-analysis R. J. Tempelman1 "Mixed effects modeling has become the primary statistical inferential engine for dairy science researchers. Originally harnessed by quantitative geneticists for estimating heritabilities and predicting breeding values of dairy cattle for economically important traits, the utility of mixed effects models has become more broadly appreciated in dairy science, particularly for the analyses of efficient experimental designs, such as Latin squares, crossovers, and repeated measures designs. The benefits of mixed models for meta-analyses in dairy science was first exposited by Dr. Normand St-Pierre in a landmark 2001 Journal of Dairy Science paper, inspiring many subsequent meta-analyses in the journal since then. With the emerging discipline of precision livestock science, dairy scientists are being increasingly drawn to various machine learning (ML) techniques for improving trait predictions. Unfortunately, many of these tools do not readily accommodate data structures that are typical of dairy science research, including environmental, temporal, or genetic relationships as well as experimental design constructs that involve effective blocking and different sizes of experimental units. Furthermore, data divisions into training and test sets for cross-validation are often purely random, thereby often leading to overoptimistic assessments of ML tools, particularly as they are applied to other typically heterogeneous environments for which these predictions are intended. The implications of different cross-validation scheme choices for assessing predictive performance of various ML tools are discussed, drawing examples from our own work and from others. Although generalized linear mixed models are not generally considered to be ML tools, their utility along with generalized additive model extensions make them an attractive option to predict responses across heterogeneous environments, particularly when, for example, genetic or environmental correlations can be specified between training and test sets. Bayesian hierarchical models will also warrant greater consideration for the analysis of discrete data, particularly when data structures are sparse."
Ruminant Nutrition Symposium: Integrating Statistics, Nutrition, and Economics—Recognizing the Contributions of ADSA Past President and Life Member Dr. Normand St-Pierre Symposium Ruminant Nutrition 2024/06/17 13:30:00 t90851 Watch 1250 Feeds vary: Should we care? 3 W. P. Weiss feed composition,variation,sampling W. P. Weiss1, N. R. St-Pierre1 "Based on the 2021 dairy NASEM, well-defined forages such as corn silage and mature alfalfa silage have coefficients of variation (CV) for CP and NDF ranging from 8% to 12%. Concentrates are usually less variable, but CV for CP and NDF are often >10%. For most feeds, mineral concentrations usually have CV >20% and often >40%. With this degree of variation, how can we formulate accurate diets? The SD in databases includes multiple sources of variation, many of which are not experienced by the cow. For forages, the major source of variation is farm to farm. This should have little consequence because nutritionists should sample forages for each farm. It does mean that table values for forages should not be used unless the inclusion rate is low (perhaps <5 of the TMR). Sampling and analytical variation (i.e., observer variation) contributes substantially to the SD in feed tables. For some feeds observer variation exceeds true variation, which means using a good table value is likely more accurate than sampling and analyzing the feed. Cows do not experience observer variation, but it can lead to poor diets if the observer (usually the nutritionist) assumes the data from the sample accurately reflects the feed being fed. Using good sampling protocols, taking duplicate independent samples, and using quality-certified labs will reduce observer variation. For most forages, within-farm true variation makes up much of the SD, and this variation is experienced by the cow. However, because the composition of feeds varies independently, a well-made TMR will be less variable than many of its ingredients. Even if best practices are applied to feed sourcing and TMR making, diets will still be variable. Based on the limited research that has been conducted evaluating the effect of diet variation on cows, substantial day-to-day variations in DM, CP, forage NDF, and fat have had little effect on production measures. Research is needed to evaluate effects of day-to-day variation in nutrients that rapidly affect rumen conditions (e.g., rumen fermentable starch). Arguably the greatest negative effect of variation in feed composition is reformulating what was a good diet by assuming observer variation is true variation."
Ruminant Nutrition Symposium: Integrating Statistics, Nutrition, and Economics—Recognizing the Contributions of ADSA Past President and Life Member Dr. Normand St-Pierre Symposium Ruminant Nutrition 2024/06/17 13:30:00 t90915 Watch 1251 A random view of the world: Because we are never absolutely sure of anything. 4 N. R. St-Pierre economics,randomness,uncertainty N. R. St-Pierre1 "Biological systems are by nature nonlinear, dynamic, and stochastic. However, we often characterize them as linear, static, and deterministic. In the process, we frequently reach improper conclusions. Examples follow. (1) Diets are often optimized using linear (LP) programming techniques, yet the exact composition of feed ingredients is not known, which is assumed by LP. Chance-constrained programming can be used to correctly optimize diets. (2) Nutrition models such as the NASEM and CNCPS contain nonlinear relationships. Thus, if they correctly predict the output of a group of animals using the average characteristics of the animals, they are inaccurate, but we conclude the opposite. Also, these models do not account for the uncertainty of the inputs. Hence, we do not know their precision, with the consequence that they cannot be properly validated. (3) Even if the concept of nutritional requirements is correct at the animal level, it does not apply to a group of heterogeneous animals that exhibits diminishing returns to scale. In these circumstances the economically optimal diet is not the one that maximizes output. (4) In research, we often measure things for which the interest is their rates of change (e.g., body weight gain) and not their absolute values (e.g., body weight). We do not know the true functional form underlying the process. Hence, we use a function that provides a good fit to the measurements. Approximate functions can produce unbiased predictions of the measurements, but they do produce biased estimates of the rates of change. This remains an unsolved problem in statistics. (5) Income risk on dairy farms arises from the uncertainty of future milk prices and the future amounts of milk sold. Futures and options markets can control price risks, but little has been done to forecast herd structure and production risk. A Markov-chain Monte Carlo approach can generate production forecasts including estimates of their uncertainty, a necessary condition to risk management. The integration of statistics, economics, and biology allows a better understanding of biological systems and proper decision-making under uncertainty."